Отдел продаж

Телефоны: (3532) 25-27-22, 93-60-02, 93-50-02

E-mail: [email protected]

г.Оренбург, ул.Беляевская, д.50/1, стр.1

 

Разное

Грунтовки с антисептиком: составы глубокого проникновения антиплесень, видео и фото

Содержание

составы глубокого проникновения антиплесень, видео и фото

Домашний ремонт – дело ответственное и трудоёмкое. Поклейка новых обоев, осуществление свежей покраски, укладка плитки обязательно нуждаются в предварительной грунтовке. Отказ от этого этапа приведёт к усложнению процесса, большему расходу материалов и ухудшению качества готовой отделки.

Антисептическая грунтовка глубокого проникновения позволит не только осуществить необходимую подготовку поверхности под нанесение финишной облицовки, но и сможет обеспечить ей высококачественную защиту от повышенной влажности, тем самым продлевая эксплуатационный срок всего здания. В данной статье мы разберём её характеристики и технологию нанесения.

Грунтовка антиплесень в ассортименте

Характеристика

Грунтовка антисептик, созданная на акриловой основе, подходит для покрытия кирпичных, бетонных, деревянных, гипсокартонных, штукатурных, гипсовых и любых других поверхностей. Она создаёт тонкий полимерный слой, который обеспечивает следующие преимущества:

Достоинства

  1. Увеличение адгезивных свойств. Возьмём для примера бетонную стену, на которую необходимо наложить слой штукатурки. Сцепление между данными веществами недостаточно надёжно, цементный раствор попросту будет сыпаться и опадать. Если же вам всё-таки удастся выполнить отделку, то в скором времени она всё равно может отслоиться, и весь труд окажется напрасным, а цена повторного ремонта немаленькой.

Грунтовка заменяет собой основание и обладает намного лучшим сцеплением. То есть, она прекрасно соединится и с бетоном, и с наносимой штукатуркой, став своеобразной прослойкой между ними. Это также справедливо и ко всем остальным материалам.

Оштукатуривание бетона после грунтования своими руками

  1. Равномерное распределение наносимой краски или клея. Шероховатости большинства покрытий способствуют скоплению жидкостей в наименее ровных частях. Грунтовка же позволяет сделать поверхность более гладкой.
  2. Уменьшение влагопоглощающих качеств. Это касается всех строительных материалов, но в особенности гидрофобной древесины. Наличие в ней множества пор обеспечивают сильнейшее впитывание любых жидкостей. Это касается как самого процесса отделки, например, чрезмерное поглощение лакокрасочных материалов, приводящее к дополнительным затратам, так и дальнейшего существования стены, потолка или пола, постоянная угроза со стороны сырости.

Полимеры перекрывают вышеозначенные поры, предотвращая доступ влаги в структуру материала.

Покрытие грунтовкой сруба

  1. Предотвращение возникновения грибков и плесени. Добавление специальных антисептических добавок делают рассматриваемый раствор идеальным для применения в таких помещениях как ванные комнаты, подвалы и кухни, а также для фасадных работ в особо влажных регионах.
  2. Защита от растрескивания, механических повреждений и атмосферных осадков.

Технические характеристики

Также следует уделить внимание и некоторым свойствам самой грунтовки с антисептиком:

  • Ориентировочный расход неразбавленного раствора на один квадратный метр составляет 90-150 грамм.
  • Размеры частиц менее 0,1 мкм.
  • Период полного застывания – полчаса.
  • Необходимая температура во время грунтования должна превышать +5 градусов Цельсия.
  • Срок хранения 6-12 месяцев в сухом тёплом месте.

Совет: при покупке в зимний период обратите внимание на наличие в магазине отапливаемого склада. Его отсутствие может свидетельствовать о непригодности смеси к использованию.

  • Примерный состав: акрил, вода, антисептик, консервант.

Совет: обязательно ознакомьтесь с прилагающейся к банке или упаковке аннотацией. Инструкция, находящаяся в ней, может содержать дополнительные данные, точность которых важна при эксплуатации.

Фото инструкции приклеенной к банке с грунтовкой

Применение

Теперь давайте рассмотрим тонкости использования грунтовки с антисептиком:

  1. Подготавливаем поверхность: 
  • Очищаем от всевозможного мусора.
  • Обезжириваем при помощи ацетона.

Подходящий раствор для ликвидации пятен

  • Дожидаемся полного высыхания.
  1. Разводим смесь с водой в указанных на упаковке пропорциях или просто вскрываем контейнер, если куплен уже готовый к применению раствор.

Совет: рекомендуется приобретать грунтовку в сухом виде. Так как её неиспользованные остатки ещё можно хранить до следующей потребности в грунтовании.

  1. Макаем в раствор кисть, выжимаем её и покрываем труднодоступные места и края обрабатываемой территории.

Грунтование области вокруг выключателя света

  1. Далее берём велюровый валик, также смачиваем его и заполняем составом всю остальную открытую площадь.

Нанесение грунтовки с антисептиком с помощью валика

  1. После полного застывания наносим его одно покрытие для улучшения результата.

Заключение

Если стены вашего дома подвержены нападению плесени, состоят из дерева или находятся в среде с повышенной влажностью, то обязательно используйте во время ремонтных работ грунтовку с антисептиком (см.также статью “Антикоррозийная грунтовка: выбор и область применения”).

Такой состав не только улучшит адгезию обрабатываемых поверхностей, но и создаст прекрасную защиту даже самому  гидрофобному материалу от всех деструктивных влияний сырости. Наносить его следует при плюсовой температуре с помощью валика и кисти в два слоя на полностью очищенную и обезжиренную поверхность.

Нанесение дополнительной защиты от сырости на половые доски

Видео в этой статье содержит материалы, которые могут предоставить вашему вниманию дополнительную информацию рассматриваемой тематики.

Защитите свой дом от чрезмерной влажности, и он значительно дольше вам прослужит.

Понравилась статья? Подписывайтесь на наш канал Яндекс.Дзен

Добавить в избранное
Версия для печати

Грунтовка с антисептиком глубокого проникновения от плесени и грибка на стенах

Эти современные средства предотвращают появление грибков с плесенью. Такие виды обработки актуальны при строительстве на последних стадиях. До того, как начнётся декоративная отделка. В этом случае грунтовка от плесени и грибка на стенах имеет смысл.

Грунтовка против грибка и плесени – что это такое и как работает

Антигрибковые грунтовки глубокого проникновения по бетону – название специальных средств, разработанных для защиты от дефектов на поверхностях. Развитие вредных микроорганизмов не стало исключением. Напольные и стеновые поверхности, потолочные перекрытия проходят обработку внутри помещении, где влажность всегда завышена.

Напольные и стеновые поверхности, потолочные перекрытия проходят обработку внутри помещении, где влажность всегда завышена.

Преимущества и недостатки

В составе таких материалов – фунгицидный препарат. Так называют специальные разновидности веществ, уничтожающие вредные микроорганизмы.

У грунтования есть и другие задачи, которые оно выполняет:

  • Защита от гниения в структуре материала;
  • Отталкивание влаги за счёт специального покрытия;
  • После окрашивания неприятные запахи нейтрализуются;
  • Отделка с повышенной прочностью;
  • Вероятность повторных трещин после окрашивания уменьшена;
  • Финишная отделка качественнее;
  • Потом отделочных материалов расходуется не так много. Это касается любых разновидностей, применяемых в строительстве.

Недостатки у такого метода обработки практически отсутствуют. В некоторых случаях это наличие вредных для здоровья выделений и веществ. Но от них легко защититься, когда применяется грунтовка противогрибковая.

После окрашивания неприятные запахи нейтрализуются.

Состав и технические характеристики

Способность уничтожать болезнетворные микроорганизмы является главным свойством для таких отделочных материалов. С помощью фунгицидов состав проникает не только на поверхность, но и вглубь. После обработки поверхности надёжно защищены от проблем в дальнейшем.

Из других важных свойств стоит отметить полную защиту от любых негативных воздействий. Покупателю остаётся только выбрать, какие характеристики важнее. И какая ему нужна грунтовка с антисептиком против плесени.

Способность уничтожать болезнетворные микроорганизмы является главным свойством для таких отделочных материалов.

Виды антибактериальных грунтовок по назначению

Состав грунтовки против плесени и грибка определяется материалом для нанесения. Разновидность отделочных верхних покрытий тоже имеет значение. Средство помогает с профилактикой вне зависимости от типа строительства или ремонта. Каждая разновидность отличается своим набором характеристик.

Средство помогает с профилактикой вне зависимости от типа строительства или ремонта.

На основе акрила

Улучшение сцепления между материалами происходит за счёт акриловых смол в составе. Главные преимущества – быстрое высыхание и отсутствие в составе вредных веществ. При сохранении влажности на высоком уровне это решение помогает обрабатывать фасады, помещения.

Главные преимущества – быстрое высыхание и отсутствие в составе вредных веществ.

На основе кварца

Антигрибковая грунтовка, созданная на основе песка. Нанесение способствует созданию шероховатости, улучшающей адгезию материалов. Нанесение слоя идёт перед окраской или другими декоративными материалами.

Нанесение способствует созданию шероховатости, улучшающей адгезию материалов.

Минеральная

Основа — цементно-гипсовая. Применяется на бетонных и кирпичных основаниях, предварительно оштукатуренных или покрытых силикатными материалами. Для здоровья человека эти разновидности составов абсолютно безопасны. Высыхание занимает всего около 2 часов. Хороший вариант.

Применяется на бетонных и кирпичных основаниях, предварительно оштукатуренных или покрытых силикатными материалами.

Алкидная

Для основ из дерева. Эксплуатационный срок увеличивается, обеспечивается защита. Выпускаются разные типы алкидных составов в зависимости от вида поверхности:

  • Кафель;
  • Стекло;
  • Сталь.

Покрытие не сочетается с гипсокартоном и перекрытиями, которые были оштукатурены. Полное высыхание занимает от 12 часов.

Некоторые средства нацелены только на профилактику, не предполагают полного уничтожения грибка. Об этом стоит помнить перед покупкой. Потому важно изучать инструкцию. Материал, на который идёт нанесение, тоже надо учитывать. Потолок ведь бывает разным.

Эксплуатационный срок увеличивается, обеспечивается защита.

Обработка антигрибковой грунтовкой, инструкция применения

Материалы наносят непосредственно на участки, которые подвергаются заражению. Но не нужно наносить вещество именно на пятна. Поверхность рекомендуется заранее промыть, чтобы очистить её. Для этого используют хлор, а потом уже прибегают к дальнейшей обработке.

Материалы наносят непосредственно на участки, которые подвергаются заражению.

Подготовка поверхности и дополнительные советы

Действие грунтовок увеличивается по времени, если позаботиться о предварительной обработке стен. После выветривания и высыхания допускается применение паяльников или фенов, чтобы обработка дала результат.

Другие рекомендации от специалистов выглядят следующим образом:

  • Очистка и предварительная сушка стен обязательна, как уже упоминалось;
  • Плесень просто очистить «белизной», разбавленной с водой. Но не стоит окончательно успокаиваться, даже если пятен больше не видно. Очищение строительным феном, паяльной лампой проходит быстрее. Но под обои такой способ лучше не применять;
  • Обязательно проветривание помещений. Конвекторы или вентиляторы справляются с этой работой внутри ванных комнат. При других обстоятельствах открывают настежь окна, создавая сквозняки;
  • Нельзя применять обычную грунтовку до того, как использована противогрибковая. Ведь другие материалы образуют защитные плёнки, которые препятствуют проникновению внутрь не только вредных микроорганизмов, но и полезных веществ;
  • Сохранение сухости в помещениях, тёплое время – оптимальные условия для работы;
  • Аэрозоли, кисти и валики качественнее всего помогают мастеру. Тем более при наличии щетины с натуральными волокнами. Благодаря такому методу состав наносят даже в труднодоступных местах.
  • Соблюдение мер безопасности обязательно во время работы. Даже если обрабатывается дерево.

Сохранение сухости в помещениях, тёплое время – оптимальные условия для работы.

Порядок работ

Распределяя состав по поверхности, берут валики или кисти, распылители. Валик сочетается с небольшими площадями. Кисть усложняет ремонтные работы, но позволяет без проблем добраться до труднодоступных мест. Распылитель берут, если площадь обработки действительно большая.

Несколько этапов входит в антигрибковую обработку:

  1. Нанесение слоя с противогрибковой грунтовкой для стен.
  2. Ждут некоторое время, пока всё высохнет.
  3. Если необходимо – наносят второй слой.
  4. Финишная отделка после полного высыхания.

Сохранение положительной температуры окружающей средой – основное условие для успешного проведения работы. Негативные факторы сохраняются одинаково при отделке внутри и снаружи. При использовании антигрибковых средств защита от вредных микроорганизмов упрощается. Выбор, какой вид грунта антигрибкового использовать в конкретном случае, определяется видом и состоянием поверхности.

Кисть усложняет ремонтные работы, но позволяет без проблем добраться до труднодоступных мест.

Расход грунтовки на 1 м2

Качество, характеристики и виды материалов для обработки влияют на то, каким будет расход материалов. Не последнюю роль играют температура с влажностью, которые сохранились в помещении. Показатель увеличивается, если грунтовки от плесени требуется хотя бы два слоя, а не один.

Расходные нормы указываются производителем на упаковке. Но мастера рекомендуют умножать стандартные коэффициенты на 1,5 минимум. Тогда проще будет предвидеть некоторые ситуации.

Для работы с бетонными поверхностями подходит большая часть универсальных составов. Производители дают рекомендации относительно мест использования и эксплуатационных условий. С ними надо ознакомиться до покупки, только в этом случае анти грибковый состав будет эффективным.

Для работы с бетонными поверхностями подходит большая часть универсальных составов.

При использовании любой грунтовки обязательно соблюдать технику безопасности и защищать себя. Инструкции и советы по работе тоже прочитываются до того, как проект начинают воплощать в жизнь. Респиратор и защитные очки необходимы каждому. Саму грунтовку хранят в тех местах, где до неё не смогут добраться дети. Не стоит сразу следовать советам о покупке составов с запасом. Докупить материалы не составит труда. А вот использовать излишки трудно – велика вероятность, что срок годности выйдет раньше. Это предостерегает и от ненужных трат.

Видео: Грунтовка от А до Я

Грунт-антисептик (пропитка) для дерева, бетона, гипсокартона

Биологической коррозии подвергаются многие материалы. Она возникает из-за воздействия гнилостных бактерий. Для того, чтобы избежать коррозии следует обрабатывать поверхности специальными составами, среди которых грунтовка с антисептиком, предназначенная для борьбы с плесенью и патогенными микроорганизмами.

Применение грунтовки с антисептиком

Водная пропитка-антисептик для дерева CETOL WV885 BPD

Антисептические грунтовки используются для защиты минеральных, деревянных и других типов поверхностей перед отделкой изделий. Необходимо учитывать, что состав не применяется для уничтожения плесени. Его назначение заключается в профилактике появления грибка. Для борьбы с плесенью используются специальные концентраты.

Назначение грунта-антисептика:

  • защита поверхностей от плесени, вредных микроорганизмов, вызывающих коррозию;
  • нанесение на верхний слой пористых поверхностей позволяет снизить коэффициент поглощения, что снижает стоимость материалов для отделки;
  • увеличение адгезионных характеристик материала;
  • создание ровной поверхности, на которую легко ложится краска и другие отделочные материалы.

Данный список показывает, что защита от плесени и грибков – это не единственная функция грунтовки с антисептиком. Другими словами, этот состав представляет собой грунтовочную смесь с добавлением веществ, предназначенных для профилактики появления грибков и вредоносных бактерий на обработанной поверхности. Но это не уменьшает полезных свойств раствора, ведь плесневые грибы приносят много вреда материалам.

Особенно подвержены плесени древесина и другие материалы, имеющие природное происхождение. Поверхность, выполненная из них, без обработки антисептическим средством становится объектом атаки вредоносных микроорганизмом, для которых она является питательным субстратом.

Таким образом, можно сказать о том, что грунтовка-антисептик предназначена для использования в строительной сфере и других областях промышленности, где требуется обработка поверхностей, склонных к поражению грибками или бактериями, перед отделкой.

Виды антисептических грунтовок

Грунтовки-антисептики встречаются различные по составу и сфере применения.

Смеси для дерева

Водный прозрачный грунт для дерева Cetol WP 562 BPD

Наиболее уязвимой перед биологической коррозией считается древесина. Она подвержена негативным воздействиям не только гнилостных бактерий и плесневых грибков, но и насекомых, наносящим изделиям из дерева большой вред. Кроме того, существуют растения-паразиты, которые могут разрушить конструкцию. Все это говорит о том, что обработка антисептической грунтовкой деревянных поверхностей является важным этапом, который нельзя исключать.

В зависимости от состава смеси могут встречаться:

  1. масляные;
  2. с органическими растворителями;
  3. на основе водных дисперсий;
  4. комбинированные.

Масляные грунты используют в том случае, если имеется необходимость в применении масляных красок или лаков. Перед нанесением на изделия смесь разводится олифой. Производители выпускают грунт, в составе которого льняное масло. Такую смесь необходимо разбавлять водой.

Грунтовки с основой в виде органических растворителей отличаются высокими техническими характеристиками. Они хорошо ложатся на структуру поверхности и обладают антисептическими функциями. Смеси имеют широкую сферу применения. Они могут использоваться для внутренних и наружных работ. При этом специалисты не рекомендуют обрабатывать этим видом грунтовки поверхности, находящиеся в жилых помещениях.

Составы с водными дисперсиями представляют собой смеси на основе различных полимеров. Грунтовки-антисептики данного вида нетоксичные и рекомендуются для внутренних работ. Они не только имеют высокие защитные свойства, но и характеризуются отсутствием неприятного запаха.

Сфера применения комбинированных антисептических грунтовок достаточно широкая. Это объясняется составом смесей, в которые могут входить обычные или полимерные масла, растворители. Данная группа грунтовок характеризуется высокой пожароустойчивостью.

Выбирая определенный вид смеси, следует ориентироваться на ее назначение. На рынке представлены грунтовки для внутренних и наружных работ, смеси для нанесения на них краски или лака и т. д. Перед покупкой обязательно следует прочитать инструкцию, расположенную на этикетке.

Смеси для гипсокартона

Гипсокартон подвергается коррозии, вызванной действиями грибка или бактерий, особенно, если в составе материала имеется целлюлоза.

Большое значение имеет обработка плит, используемых в помещениях с высокой влажностью, в том числе в ванных комнатах и санузлах, на балконах и лоджиях.

Особое внимание нужно обратить на торцы и стыки плит гипсокартона. Если грибок появится в этих местах, то он с легкостью проникнет внутрь изделия, и избавиться от него будет достаточно сложно.

Перед тем, как начать шпатлевать, необходимо обработать гипсокартон антисептической грунтовкой на основе акрила. Процедуру следует повторить через 30 минут. Только после этого можно начинать шпатлевку.

Некоторые специалисты не рекомендуют обрабатывать гипсокартон. Такой подход в корне неправильный. Гипсокартон, используемый для помещений с высокой влажностью, необходимо грунтовать смесью, обладающей антисептическими свойствами. Следует обрабатывать каждый нанесенный слой шпатлевки.

Смеси для бетона

Для материалов с высокой плотностью используются грунтовые смеси на водной основе. Их применяют для бетонных плит, стен из кирпича или камня и др.

Изолирующий грунт Alphacryl Primer

Специалисты также рекомендуют битумный праймер для обработки бетона. В его состав обычно включаются антисептики и фунгициды. Битумный праймер применяется для грунтования фундамента перед укладкой материалов для гидроизоляции.

На упаковке составов для бетона не всегда указывается, что они предназначены именно для него. Такая грунтовка может относиться к универсальным смесям и предназначаться для обработки различных минеральных оснований.

Перед нанесением состав следует развести обычной водой в соответствии с инструкциями, указанными на упаковке. Для этого потребуется валик и строительная кисть. Так как смеси различаются между собой, то пропорции разведения могут отличаться с разными составами. Чтобы точно знать, как развести раствор, необходимо внимательно изучить инструкцию.

Видов плесневых грибов встречается большое количество, при этом с ними можно столкнуться в самых неожиданных местах. Чтобы этого избежать, требуется обработка поверхности смесями с фунгицидами. Особенно важно использование грунтовки при выполнении внутренних работ и в помещениях с высокой влажностью. Плесневый грибок опасен для здоровья человека, так как выделяет токсины, провоцирующие различные заболевания.

Это интересно! Те пятна, которые проступают на поверхности конструкции, не являются самим грибом. Это лишь его тело, носящее функцию размножения. Сама грибница из нитей мицелия находится непосредственно внутри материала, поэтому ее размеры снаружи определить невозможно.

Грунт-антисептик для дерева Cetol HLSe

Поверхности из минеральных материалов требуют нанесения грунта для хорошей сцепки с наносимой отделкой и обработки фунгицидами для избегания появления плесневого грибка. В настоящее время можно использовать комплексные составы, выполняющие сразу обе функции. Стоимость антисептических грунтов выше, чем обычных, однако, уменьшаются временные и трудовые затраты. Кроме того, смеси помогут продлить срок службы конструкций.

 

Грунтовка глубокого проникновения VGT ВД-АК-0301 с антисептиком 5 кг, цена

Грунтовка глубокого проникновения VGT ВД-АК-0301 с антисептиком 5 кг
 
Грунтовка глубокого проникновения VGT ВД-АК-0301 представляет собой молочно-белую маслянистую на ощупь жидкость. После высыхания образует ровную, матовую полупрозрачную поверхность. Снижает расход краски. Выравнивает впитывающую способность основания, создаёт в поверхностном слое на глубину проникновения “дышащую” водонепроницаемую плёнку. Может использоваться для защиты поверхностей от насыщения влаго…

Читать далее

Антигрибковая добавка
?

Специальные добавки в составе, предотвращающие развитие грибка и плесени.

Да
Марка
ВД-АК-0301
Материал основания
?

Перечень материалов, на которые можно наносить смесь. В зависимости от этого подбирается продукт с определенными функциональными свойствами.

Дерево, Бетон, Кирпич
Объекты применения
?

Объекты — то, на что непосредственно наносится смесь. Это могут быть стены, полы, потолки, фасады, цоколи и т.д.

Для пола, Для стен
Основа
?

Связующие вещества, которые скрепляют между собой другие компоненты смеси.

Водно-дисперсионная
Страна производства
Россия
Тип грунтовки
?

Адгезионная грунтовка характеризуется улучшенным сцеплением финишного слоя с основной поверхностью.
Бетоноконтакт представляет собой особый состав, используемый для приклеивания стандартных отделочных материалов к достаточно необычным поверхностям.
Грунтовки глубокого проникновения специальный состав, который применяется при рыхлых и пористых основаниях.
Грунтовки для впитывающих оснований укрепляют поверхность и снижает впитывающую способность оснований.
Для укрепления поверхности, хорошего сцепления с основанием используют грунтовку Под декоративную штукатурку
Укрепляющая грунтовка оказывает на материал воздействие, аналогичное грунтовкам глубокого проникновения, но по составу отличается большим количеством клеящего вещества

Глубокого проникновения
Тип применения
?

По типу применения можно выделить смеси для внутреннего (внутри помещения) и наружного (снаружи помещения) использования.

Для внутреннего применения, Для наружного применения
Тип финишного покрытия
?

Материалы, которые можно нанести на смесь в качестве финишной отделки. К ним можно отнести обои, краски, шпатлевки, плитки и т.д.

Под покраску, Под обои, Под плитку, Под штукатурку

Грунтовка-антисептик для внутренних и наружных работ: составы для дерева и другие виды

Che Guevara

7411
0
5

Грунтовочный антисептик для дерева от финской компании Tikkurila.

Многие материалы подвержены биологической коррозии (ржавчина) за счет действия гнилостных бактерий, поэтому им необходима обработка специальными препаратами. Одним из них является грунтовка с антисептиком против плесени и патогенных микроорганизмов. Ниже я расскажу все о разновидностях таких составов, области их применения и свойствах.

Назначение антисептических грунтовок

Обработка плиты OSB акриловым противогрибковым грунтом.

Грунтовки-антисептики предназначены для обработки минеральных, деревянных и прочих поверхностей перед отделкой. Следует понимать, что это именно грунтовка, а не средство для уничтожения плесени.

Для борьбы с разросшимся грибком применяют специальные концентраты, а противогрибковая грунтовка служит для предупреждения его появления.

Плодовые тела плесневого гриба под микроскопом.

Основные свойства антисептического грунта:

  • Заполнение верхнего слоя пористых поверхностей для уменьшения его коэффициента поглощения и уменьшения затрат на отделку;

Обработка бетонного основания.

  • Укрепление пористых оснований, предупреждение крошения и растрескивания;

Проникновения частиц грунта в поры основания.

  • Повышения адгезионных свойств поверхности, то есть её способности к надежной сцепке со слоем последующей отделки;

Обработка основания гипсокартона для повышения сцепки со шпаклевкой.

  • Создание поверхности, которая равномерно впитывает краску или другой отделочный материал для более удобной работы при окраске;

Краска ложится равномерно и требует нанесения меньшего количества слоев.

  • Защита материала от поражения плесневыми грибами, гнилостными микроорганизмами и другими биологическими агентами, способными вызвать коррозию.

Защита от плесеней и бактерий.

Как видно из этого списка, борьба с плесенью и гнилью – это одна из многих функций, которые выполняет грунтовка с антисептиком. Говоря проще, перед нами обычная грунтовочная смесь, в которую добавлены препараты для борьбы с появлением грибка и бактерий.

Основная функция грунтовки – укрепление поверхности и повышение её адгезионных свойств.

Этот факт нисколько не умаляет важности подобных составов. Вред, наносимый плесневыми грибами, может быть огромным.

Материалы природного происхождения, такие как древесина, без подобной обработки и вовсе становятся объектом атаки различных организмов, для которых деревянные изделия — питательный субстрат.

Дерево особенно подвержено действию грибка и бактерий.

Резюмируя, скажу так: антисептические грунты предназначены для обработки поверхностей перед отделкой, если существует опасность поражения материалов плесенью или бактериями.

Разновидности антисептических грунтовок

Составы для дерева

Грунт для работы по дереву.

Древесина более других материалов подвержена биологической коррозии. Её поражают:

  • плесневые грибы,
  • гнилостные бактерии,
  • растения-паразиты,
  • насекомые-древоточцы.

Поэтому комплексная обработка деревянных конструкций особенно важна.

Обработка фасада деревянного дома грунтовкой для стен против грибков и плесени.

Различают такие виды грунтовок для древесины:

  1. Масляные. Эти составы, как правило, требуют разбавления олифами и служат для последующего нанесения масляных красок и лаков. Также бывают грунты на основе льняного масла, которые разбавляются водой.

Масляная грунтовка для дерева.

  1. На основе водных дисперсий. Это латексные составы на основе акрилатов и других полимеров. Отличаются отсутствием неприятного запаха, нетоксичны, хорошо подходят для внутренних работ.

Водно-дисперсионный состав.

  1. На основе органических растворителей. Глубоко проникают в структуру и хорошо обеззараживают материал. Могут применяться как для наружных, так и для внутренних работ, однако для обработки жилых помещений я бы их не рекомендовал.

Грунтантисептик для дерева для наружных работ на основе уайт-спирита.

  1. Комбинированные. Могут содержать в составе масла и растворители, а также полимерные масла. Отличаются высокой степенью защиты, зачастую обладают противопожарными свойствами.

Комбинированный биозащитный состав.

При выборе материала следует учитывать, где и для чего вы будете его применять. Необходимо различать составы для внутренних и наружных работ, грунтовки под лак и масляную краску, масло-воски и прочие пропитки. Инструкция на этикетке обязательна к прочтению.

Для гипсокартона

Для стен из гипсокартона (ГКЛ) подойдет только акриловый грунт глубокого проникновения.

Минеральные основания также подвержены воздействию грибка, особенно это касается гипсокартона, так как в его составе есть целлюлоза, которую любит мицелий плесени. Подобные составы могут применяться для пенобетона, штукатурок и прочих подобных материалов.

Перед началом монтажа каркаса для ГКЛ грунтуют стены антисептиком.

Особенно важно обрабатывать противогрибковой грунтовкой гипсовые плиты, которые предполагается эксплуатировать во влажных помещениях:

  • на балконах,
  • лоджиях,
  • кухнях,
  • ванных комнатах,
  • санузлах.

На фото — пример фунгицидной грунтовочной смеси отечественного производителя.

Не забывайте обрабатывать торцы и стыки – это наиболее опасные места. Сквозь них влага вместе со спорами плесени проникает внутрь материала. Если гриб начнет расти, вывести его будет очень сложно.

Особое внимание уделяйте стыкам и торцам.

Перед нанесением первого слоя шпаклевки, обработайте всю поверхность стен биозащитным грунтовочным составом глубокого проникновения на основе акрила. Через полчаса повторите процедуру.

Наносите состав в два слоя.

Не слушайте доморощенных экспертов. Гипсокартон грунтовать необходимо, а во влажных помещениях – грунтовкой с добавлением антисептиков и фунгицидов. Более того, каждый слой шпаклевки также грунтуется.

Грунтовки по бетону

Подобный состав подойдет не только для бетона, но и для прочих схожих поверхностей – кирпич, камень и т.д.

Для плотных минеральных оснований применяют грунты на водной основе. Такие составы, как правило, можно использовать для кирпичных и каменных стен, бетонных плит и ЖБК.

Грунтование бетонной стены.

Кроме того, для бетона применяют битумный праймер. Он используется для грунтовки фундаментов перед нанесением битумной мастики или рулонных материалов для гидроизоляции. В такие праймеры также часто добавляются фунгициды и антисептики.

Битумный праймер для бетонного фундамента.

Часто на упаковке не указано, что состав предназначен исключительно для бетона. Он может быть универсальным или пригодным для любых минеральных оснований.

Универсальное средство для минеральных оснований.

Наносятся подобные смеси после разведения водой в пропорции, указанной на этикетке. Это может быть от 1:1 до 30:1, поэтому внимательно читайте инструкцию. Работу легко выполнить своими руками с помощью валика и строительной кисти (макловицы).

Грунтование бетона перед штукатуркой – обязательная процедура, как, впрочем, и грунтование штукатурки перед обоями.

Существует огромное количество плесневых грибов. Они способны жить в самых неожиданных местах и питаться самыми разными субстратами.

Поэтому обработка поверхностей фунгицидами обязательна, особенно во время внутренних работ и во влажных помещениях. Помните, грибок может выделять опасные токсины, которые провоцируют целый ряд заболеваний.

Вы можете даже не подозревать о заражении.

Разноцветные пятна, которые мы видим на поверхности стены или деревянной конструкции – это далеко не весь гриб. Это его плодовое тело, которое выполняет функцию размножения. Сам организм находится внутри материала, образуя грибницу из нитей мицелия, размеры которой предугадать сложно.

Вывод

После прочтения статьи вам стало известно, что не обязательно наносить фунгицид и грунт по отдельности. Цена комплексных составов несколько выше, зато вы заранее избавите себя от массы проблем, связанных не только с разрушением конструкций, но и с собственным здоровьем.

Видео в этой статье не даст мне соврать. Если же вы хотите задать вопрос – пишите в комментариях!

Понравилась статья? Подписывайтесь на наш канал Яндекс.Дзен

28 ноября 2016г.

Если вы хотите выразить благодарность, добавить уточнение или возражение, что-то спросить у автора — добавьте комментарий или скажите спасибо!

виды, свойства грунта от плесени

Ключевое средство, предназначенное для борьбы с колониями вредных микроорганизмов – антигрибковая грунтовка для стен, именуемая еще фунгицидной, антисептической или антибактериальной. Плесневые грибы на стенах – самая частая проблема, с которой сталкивается большинство домовладельцев.

 

Плесени свойственно не только губить декоративную отделку, но и разрушать поверхность, а также наносить серьезный вред здоровью окружающих. Особенно часто грибок поражает влажные поверхности. Исключить вероятность образования грибковых спор необходимо еще на этапе чистовых или отделочных работ.

Свойства и виды антигрибкового грунта

Фунгицидные грунтовкижидкость, включающая в свой состав органический растворитель и специальные химические добавки. Их задача – препятствовать образованию плесневых грибов, а при появлении первых спор – уничтожать их.

Основную роль в составе играют фунгициды, которые, вступая в реакцию с новообразованиями, способствуют их разрушению.

Грунтовка против плесени и грибка производится в двух формах:

  1. Обычный антигрибковый состав, используемый для обработки «здоровых» поверхностей. Такой грунт является своеобразным профилактическим средством.
  2. Концентрированная антибактериальная грунтовка. Ее цель – уничтожение уже образовавшегося грибка. Проникая вглубь основания, состав предупреждает возникновение даже моховых наростов и разрушает их.

Назначение

В зависимости от типа обрабатываемого основания грунтовка с антигрибковыми добавками подразделяется на несколько специализированных типов:

  • грунт для дерева;
  • для бетона;
  • для штукатурки;
  • для шпаклевки;
  • для кирпича;
  • для гипсокартона и т.д.

Также антигрибковая грунтовка для стен может быть универсальной. То есть она подходит для обработки всех перечисленных типов оснований, но ее эффект для одной поверхности может проявляться в большей мере, чем для другой. Поэтому лучше отдать предпочтение узкоспециализированному грунту.

Виды

Наряду с предотвращением размножения плесневых спор фунгицидные грунтовки еще должны выполнять главную функцию грунта – упрочнять плоскость, улучшать ее адгезию или глубоко пропитывать основу. С этим прекрасно справляются имеющиеся виды:

  1. Антигрибковая грунтовка глубокого проникновения. Она, проникая в структуру, связывает все отслоившиеся и рыхлые части, тем самым усиливая поверхность. При этом создается тончайший слой, защищающий основание от влаги и сокращающий расход шпаклевки или краски. Глубина проникновения состава может достигать 7 см.
  2. Пенетрирующая грунтовка с антисептиком против плесени. Ее основная задача – укрепление пористых или рыхлых оснований, при проникающей способности не менее 0,5 см.
  3. Адгезионные грунты. Благодаря им обеспечивается хорошее сцепление отделки с основанием;
  4. Специальная антибактериальная грунтовка. Такие составы наделены специфическими свойствами, среди которых морозоустойчивость или стойкость к коррозии.

Антигрибковая грунтовка, цена которой колеблется в пределах от 500 до 870 р. за ведро 10 л, может несколько различаться по составу, что и послужило поводом для следующей классификации:

  • Алкидная грунтовка с антигрибковыми добавками;
  • Акриловая;
  • Минеральная.

Расход антигрибковой грунтовки в среднем равен 150-400 г/м2 на 1 слой. Специалистами рекомендуется обрабатывать поверхности, в особенности неровные или сильно впитывающие, минимум два раза. Средняя плотность – 1000 кг/м3. Время высыхания – 30-120 мин.

Причины появления плесени

Выявить плесень на ранних этапах практически невозможно, поскольку споры начинают появляться в структуре поверхности, разрушая ее изнутри. Первые признаки образовавшего грибка – пятна, отличные от цвета отделки (бурые, серые, черные).

Поэтому антигрибковая грунтовка глубокого проникновения или обычный антигрибковый состав должны использоваться на всех этапах черновой и даже беловой отделки (штукатурка, шпаклевка).

Плесень может образоваться совершенно в любом помещении. Причинами ее появления, чаще всего, является недобросовестность строителей или же брак стройматериалов.

В частности, причинами размножения плесневых грибов являются:

  • Недостаточная гидроизоляция оснований, что приводит к проникновению влаги в толщу, где она постепенно накапливается. Поверхность постоянно влажная, что и нужно для роста грибка.
  • Холодные основания, к тому же подверженные промерзанию. Чаще всего такое можно наблюдать в панельных строениях, когда попался бракованный строительный блок без утеплителя в толще. Также промерзающие стены – проблема нежилых или сезонно заселяемых строений с нарушенной теплоизоляцией.
  • Некачественно заделанные межпанельные стыки.
  • Старые протекающие крыши или достаточно холодные чердачные помещения.
  • Плохая вентилируемость помещения, в том числе нерегулярность проветривания или некачественно установленные оконные блоки.
  • Деревянные поверхности или полы, которым свойственна чрезмерная способность к влагопоглощению.

Профилактические меры

Грунтовка с антисептиком против плесени должна выбираться исходя из типа поверхности (бетон, кирпич, дерево и т.д.), состояния основания (рыхлое, старое, пористое), специфики помещения (устойчивая влажность или неустойчивая).

Поскольку антигрибковая грунтовка для стен – только профилактическая мера, целесообразно осуществить ряд мероприятий, чтобы предотвратить образование плесени:

  • Ликвидировать причину проникновения влаги. Для жителей верхних этажей или собственников частных строений – периодически проверять целостность крыши. Жителям нижних же этажей – дополнительно гидроизолировать пол.
  • Обеспечить помещение должной вентиляцией и следить за ее функционированием.
  • Устранять все протечки связанные с канализационными и водопроводными разветвлениями.
  • Частные строения дополнительно тепло- и гидроизолировать.
  • Периодически проветривать помещения, в частности нежилые, дополнительно протапливая их.

В отношении «проросшего» грибка нужно знать: чтобы искоренить плесень, нужно не только снять всю зараженную отделку, но и обжечь участок газовой горелкой. Это поможет высушить стену и уничтожить грибок.

Затем на очищенную плоскость наносится грунтовка против плесени и грибка. Расход антигрибковой грунтовки напрямую зависит от пористости основания. Однако даже относительно плохо впитывающие основания нуждаются в двух- или трехкратной обработке.

Антигрибковая грунтовка для стен обойдется значительно дешевле, чем демонтаж существующей отделки и замена ее на новую. Соответственно, такая обработка в случае возникновения плесени – неотъемлемый этап ремонтных работ, даже если речь идет о помещениях со стабильной влажностью.

Антигрибковая грунтовка для стен, видео

Грунтовка с антисептиком БИРСMIX — Базабирс Обзор грунтовок

Назначение грунтовок с антисептиком

Грунтовка с антисептиком обеспечивает защиту пористым и слабым основаниям от грибка и плесени. Такие средства образуют защитную пленку на обрабатываемой поверхности, чем не дают возможности плесени и грибку проникнуть в стены. Также грунтовка антисептик обладает эффектом отпугивания насекомых.

Антисептические грунтовки предназначены для обработки различного рода оснований перед выполнением отделочных работ. Такие покрытия применяются для профилактики грибковых инфекций, а не для борьбы с уже имеющейся плесенью.

Основные свойства грунтовки с антисептиком:

  • заполнение верхнего слоя пористых оснований для уменьшения его коэффициента поглощения;
  • предупреждение крошения и растрескивания пористых оснований;
  • повышение адгезионных свойств поверхности;
  • создание поверхности, которая равномерно впитывает краску или другой отделочный материал;
  • защита от поражения плесневыми грибами и другими вредными микроорганизмами.

Как видно из этого списка, борьба с грибком – это одна из многих функций грунта с антисептиком. Другими словами, грунт с антисептиком — это обычная грунтовка, в которую добавлены антисептические препараты.

От правильной подготовки стен во многом зависят такие параметры, как общее качество отделки, вне зависимости от разновидностей поверхности. Грунтовка глубокого проникновения с антисептиком в этом плане самая эффективная. Она лучше других справляется с задачей повышения адгезии, укрепления рыхлых материалов, предотвращение развития грибков и плесени.

Грунтовки с антисептиком БИРСMIX

При отделке стен и других поверхностей всегда требуется проведение подготовительных работ. Многие из них не обходятся без грунтования. Наиболее часто для этого используют грунтовку глубокого проникновения с антисептиком.

Данные составы пользуются большой популярностью и значительно продлевают долговечность ремонта.

Грунтовку используют перед окрашиванием, шпаклеванием, поклейкой обоев, укладкой плитки, декоративной отделкой стен, пола и в других случаях при строительстве и ремонте.

Основной функцией грунтовок БИРСMIX является укрепление поверхности и снижение впитывающей способности любого основания, что препятствует преждевременному впитыванию влаги из строительного раствора, и тем самым обеспечивается равномерное твердение.

Грунтовки с антисептиком БИРСMIX:

  • обладают антисептическими свойствами, что позволяет избежать образования плесени и грибка;
  • не снижают паропроницаемости основания;
  • используются для наружных и внутренних работ.

Грунт глубокого проникновения АНТИСЕПТИК для внутренних и наружных работ, БИРСMIX

Грунт глубокого проникновения АНТИСЕПТИК для внутренних работ, БИРСMIX

Грунтовка глубокого проникновения с антисептиком используется для укрепления обрабатываемой поверхности, выравнивания впитывающей способности, повышения адгезии к окрашиваемой поверхности и покрывным слоям перед нанесением шпатлевок, водно-дисперсионных красок, а также перед оклеиванием обоями.

Теперь вы понимаете, что не обязательно наносить фунгицид и грунтовку по отдельности. Грунтовка с антисептиком БИРСmix избавляет вас от многих неприятностей и лишней работы.

Антисептическая чувствительность и распределение генов антисептической устойчивости у метициллин-устойчивого золотистого стафилококка | Письма о микробиологии FEMS

636″ data-legacy-id=»ss1″> 1 Введение

Метициллин-устойчивый Staphylococcus aureus (MRSA) является клинически значимым патогеном, поскольку MRSA устойчив к целому ряду антибиотиков и вызывает внутрибольничные инфекции во всем мире. Кроме того, из клинических образцов выделен устойчивый к антисептикам и дезинфицирующим средствам MRSA [1, 2]. Сообщалось, что два гена, qacA [3] и qacB [4], придают высокий уровень устойчивости к антисептикам, и четыре гена, а именно qacC, qacD [5], ebr [6 ] и smr [7], придают устойчивость низкого уровня.Эти гены устойчивости к антисептикам придают перекрестную устойчивость к широкому спектру структурно разнородных лекарств, а устойчивость обусловлена ​​энергозависимыми механизмами оттока лекарств [5, 7, 8]. Анализ нуклеотидных последовательностей показывает, что qacA очень похож на qacB [4], а smr совпадает с qacC, qacD и ebr [7]. Следовательно, гены устойчивости к антисептикам можно структурно разделить на два семейства: qacA и smr .

Поскольку вспышки внутрибольничных инфекций, вызванных MRSA, впервые стали серьезной проблемой, контрмеры были сосредоточены на профилактике инфекции, а не на лечении. Для предотвращения инфекций, вызываемых MRSA, используются различные антисептики и дезинфицирующие средства, а история устойчивости к антибиотикам позволяет нам с уверенностью прогнозировать появление и распространение устойчивых к антисептикам бактерий. qacA и smr обнаруживаются не только у S. aureus , но и у коагулазонегативных стафилококков [9].Однако почти все исследованных штаммов S. aureus были выделены до 1989 года.

Чтобы идентифицировать гены устойчивости к антисептикам у MRSA и определить, появились ли в последнее время в Японии новые устойчивые штаммы, мы изучили чувствительность к антисептикам и распространение типичных антисептиков. -гены устойчивости, qacA и smr , в MRSA.

641″ data-legacy-id=»ss2-1″> 2.1 Штаммы бактерий

В данном исследовании было отобрано 98 штаммов MRSA, выделенных из разных больниц, расположенных в разных регионах.Эти штаммы были собраны в 1992 году со всей Японии Токийским центром клинических исследований. Чувствительные к антисептикам S. aureus RN27, RN450, RN2677 [10], JCM2143, JCM2847, FDA209P, MS353 [11] использовали в качестве эталонных штаммов для определения минимальной ингибирующей концентрации (МИК). RN2677 и RN2677, несущие плазмиду pTZ20, кодирующую smr [6], использовали в качестве отрицательного и положительного контролей для полимеразной цепной реакции (ПЦР) соответственно.

645″ data-legacy-id=»ss2-3″> 2.3 Получение ДНК

ДНК

получали для ПЦР из S. aureus следующим образом. Одну колонию из чашки с трипто-соевым агаром суспендировали в 100 мкл лизирующего буфера (10 мМ трис-HCl, pH 8.0, 10 мМ NaCl, 0,1 М ЭДТА, 2 мкг мл -1 лизостафина (Вако, Осака, Япония)) и инкубировали при 37 ° С в течение 30 мин. После центрифугирования осадок клеток ресуспендировали в 1 мл воды и нагревали при 95 ° C в течение 10 мин. Суспензию центрифугировали при 10 000 об / мин в течение 5 мин и супернатант использовали в качестве образца ДНК для ПЦР. Плазмидную ДНК выделяли с помощью системы очистки ДНК Wizard plus minipreps (Promega, Madison, WI). В случае S. aureus клетки суспендировали в буфере для клеточной суспензии, содержащем 50 мкг / мл -1 лизостафина и 1 мг / мл -1 лизоцима, и инкубировали в течение 30 минут при 37 ° C.

SMR Прямой праймер 5′-CTATGGCAATAGGAGATATGGTGT 417 [6] Обратный праймер 5′-CCACTACAGATTCTTCAGCTACATG Справочник

qacA

Прямой праймер 5′-

ATGCCTTATATTTATTTAATAATAGCC 321 [3]

Обратный праймер 5′-

ATGCGATGTTCCGAAAATGTTTAAC smr Прямой праймер 5′-CTATGGCAATAGGAGATATGGTGT 417 [6]

Последовательности праймеров, использованных для амплификации qacA и smr

qac8

Прямой праймер 5′-

Обратный праймер 5′-

SMR

TCCGAAAATGTTTAAC

SMR

Прямой праймер 5′-

Обратный праймер 5′-

Праймер Последовательность Размер продукта (п.н.) Ссылка

ATGCCTTATATTTATTTAATAATAGCC 321 [3]
ATGCGATGTTCCGAAAATGTTTAAC
Прямой праймер 5′-CTATGGCAATAGGAGATATGGTGT 417 [6]
Обратный праймер 5′-CCACTACAGATTCTTCAGCTACATG Ссылка
qacA
Прямой праймер 5′-ATGCCTTATTATTTA
CTATGGCAATAGGAGATATGGTGT 417 [6]
CCACTACAGATTCTTCAGCTACATG

652″ data-legacy-id=»ss3″> 3 Результаты

МИК EB (мкг мл — 1 ) ≥1.56 3,13 6,25 12,5 25 50 100 200 > 200 Всего ≥3,13 1

2 6,25 2 4

5 19 1 20 25 11

18 (1 с) 50 1 2 (1 с) 8 (6 с) 100 1 4 (4 с) 5 (4 с) 200 1 (1 с) 1 (1 с) 5 (3 с) 400

9012 7 3 5 3 (3 с) 2 (2 с) 13 (5 с) > 400

12

6 1 (1a) 9 (9a) 18 (10a) Всего 1 3 23 13 16 (2 с) 12s) 3 (3s) 4 (3s + 1a) 9 (9a) 98 (20s + 10a)

5

9012 7

12

MIC AF (мкг мл −1 ) МИК EB (мкг мл -1 )
≥1.56 3,13 6,25 12,5 25 50 100 200 > 200 Всего
≥3,13 1

2
6,25 2 4 19 1 20
25 11

18 (1 с)
50 1 2 (1 с) 8 (6 с) 100 1 4 (4 с) 5 (4 с)
200 1 (1 с) 1 (1 с) 5 (3 с)
400 3 5 3 (3 с) 2 (2 с) 13 (5 с)
> 400 6 1 (1a) 9 (9a) 18 (10a)
Всего 1 3 23 13 16 (2 с) 12s) 3 (3s) 4 (3s + 1a) 9 (9a) 98 (20s + 10a)

2

Распределение МИК EB и AF и антисептических генов qacA и smr в 98 изолятах MRSA

5

9012 7

12

МИК AF (мкг мл -1 ) МИК EB (мкг мл -1 )
≥1.56 3,13 6,25 12,5 25 50 100 200 > 200 Всего
≥3,13 1

2
6,25 2 4 19 1 20
25 11

18 (1 с)
50 1 2 (1 с) 8 (6 с) 100 1 4 (4 с) 5 (4 с)
200 1 (1 с) 1 (1 с) 5 (3 с)
400 3 5 3 (3 с) 2 (2 с) 13 (5 с)
> 400 6 1 (1a) 9 (9a) 18 (10a)
Всего 1 3 23 13 16 (2 с) 12s) 3 (3s) 4 (3s + 1a) 9 (9a) 98 (20s + 10a)

5

9012 7

12

MIC AF (мкг мл −1 ) МИК EB (мкг мл -1 )
≥1.56 3,13 6,25 12,5 25 50 100 200 > 200 Всего
≥3,13 1

2
6,25 2 4 19 1 20
25 11

18 (1 с)
50 1 2 (1 с) 8 (6 с) 100 1 4 (4 с) 5 (4 с)
200 1 (1 с) 1 (1 с) 5 (3 с)
400 3 5 3 (3 с) 2 (2 с) 13 (5 с)
> 400 6 1 (1a) 9 (9a) 18 (10a)
Всего 1 3 23 13 16 (2 с) 12s) 3 (3s) 4 (3s + 1a) 9 (9a) 98 (20s + 10a)

3

МПК антисептиков и фторхинолонов против 98 изолятов MRSA

SP

> 200 /> 200)

)

Группа No.штамма Ген Диапазон MIC (MIC 50 / MIC 90 )
EB AF BT CH N

A 10 qacA ≥200 > 400 3,13–12,5 3,13–12,5 1,56–> 200 ND128

(> 400 /> 400) (12.5 / 12,5) (3,13 / 3,13) (25 /> 200)
smr 25–400 25–400 3,13–6,25 1,56–3,13 1,56–> 200 0,05–> 25
(100/400) (6.25 / 6,25) (3,13 / 3,13) (3,13 / 200) (0,1 / 25)
128 19 ( norA ) 25–50 100–> 400 3,13–6,25 1,56–3,13 25–> 200 0,1 50
(50/50) (400 /> 400) (3.13 / 3,13) (3,13 / 3,13) (3,13 / 3,13) (6,25 / 25)
22 12,5–50 12,5–100 1,56–3,13 1,56–3,13 0,78–> 200 0,05–> 50
128 5/25) (25/50) (1,56 / 3,13) (1,56 / 1,56) (50 /> 200) (6,25 / 25)
S 27 1,56–6,25 3,13–12,5 0,39–0,7128 0,39–0,7128
(6.25 / 6,25) (12,5 / 12,5) (0,78) (0,78 / 0,78) (100 /> 200)
128
R 7 1,56–6,25 3,13–12,5 0,78–1,56 0,78–1,56 0,78–1,56 0,78–1,56 (3.13 / 6,25) (6,25 / 12,5) (1,56 / 1,56) (1,56 / 1,56) (1,56 / 1,56) (0,1 / 0,2)

Номер штамма

SP

( norA )

(3,13 / 3,13)

50)

Группа Ген Диапазон MIC (MIC 50 / MIC 90 )
EB AF BT CH X
A 10 qacA ≥200 > 400 3.13–12,5 3,13–12,5 1,56–> 200 ND
(> 200 /> 200) (> 400 /> 400) (12,5 / 12,5) (3,13 / 3,13) (25 /> 200)
25–400 25–400 3.13–6,25 1,56–3,13 1,56–> 200 0,05–> 25
(50/200) (100/400) (6,2128 / 6,25)

(3,13 / 3,13) (3,13 / 200) (0,1 / 25)
25–50 100–> 400 3.13–6,25 1,56–3,13 25–> 200 0,1 50
(50/50) (400 /> 400) (3,13 / 3,17) (3,13 / 3,13) (6,25 / 25)
12.5–50 12,5–100 1,56–3,13 1,56–3,13 0,78–> 200 0,05–> 50
(12,5 / 25) (1,56 / 3,13) (1,56 / 1,56) (50 /> 200) (6,25 / 25)
S 27 1.56–6,25 3,13–12,5 0,39–0,78 0,39–1,56 0,39–> 200 н.э.

(0,78) (0,78 / 0,78) (100 /> 200)
1.56–6,25 3,13–12,5 0,78–1,56 0,78–1,56 0,78–1,56 0,05–0,2
(3,1128) (1,56 / 1,56) (1,56 / 1,56) (1,56 / 1,56) (0,1 / 0,2)

3

МИК антисептиков и фторхинолонов против 98 изолятов MRSA

Группа

SP

> 200 /> 200)

)

№штамма Ген Диапазон MIC (MIC 50 / MIC 90 )
EB AF BT CH N

A 10 qacA ≥200 > 400 3,13–12,5 3,13–12,5 1,56–> 200 ND128

(> 400 /> 400) (12.5 / 12,5) (3,13 / 3,13) (25 /> 200)
smr 25–400 25–400 3,13–6,25 1,56–3,13 1,56–> 200 0,05–> 25
(100/400) (6.25 / 6,25) (3,13 / 3,13) (3,13 / 200) (0,1 / 25)
128 19 ( norA ) 25–50 100–> 400 3,13–6,25 1,56–3,13 25–> 200 0,1 50
(50/50) (400 /> 400) (3.13 / 3,13) (3,13 / 3,13) (3,13 / 3,13) (6,25 / 25)
22 12,5–50 12,5–100 1,56–3,13 1,56–3,13 0,78–> 200 0,05–> 50
128 5/25) (25/50) (1,56 / 3,13) (1,56 / 1,56) (50 /> 200) (6,25 / 25)
S 27 1,56–6,25 3,13–12,5 0,39–0,7128 0,39–0,7128
(6.25 / 6,25) (12,5 / 12,5) (0,78) (0,78 / 0,78) (100 /> 200)
128
R 7 1,56–6,25 3,13–12,5 0,78–1,56 0,78–1,56 0,78–1,56 0,78–1,56 (3.13 / 6,25) (6,25 / 12,5) (1,56 / 1,56) (1,56 / 1,56) (1,56 / 1,56) (0,1 / 0,2)

Номер штамма

SP

( norA )

(3,13 / 3,13)

50)

Группа Ген Диапазон MIC (MIC 50 / MIC 90 )
EB AF BT CH X
A 10 qacA ≥200 > 400 3.13–12,5 3,13–12,5 1,56–> 200 ND
(> 200 /> 200) (> 400 /> 400) (12,5 / 12,5) (3,13 / 3,13) (25 /> 200)
25–400 25–400 3.13–6,25 1,56–3,13 1,56–> 200 0,05–> 25
(50/200) (100/400) (6,2128 / 6,25)

(3,13 / 3,13) (3,13 / 200) (0,1 / 25)
25–50 100–> 400 3.13–6,25 1,56–3,13 25–> 200 0,1 50
(50/50) (400 /> 400) (3,13 / 3,17) (3,13 / 3,13) (6,25 / 25)
12.5–50 12,5–100 1,56–3,13 1,56–3,13 0,78–> 200 0,05–> 50
(12,5 / 25) (1,56 / 3,13) (1,56 / 1,56) (50 /> 200) (6,25 / 25)
S 27 1.56–6,25 3,13–12,5 0,39–0,78 0,39–1,56 0,39–> 200 н.э.

(0,78) (0,78 / 0,78) (100 /> 200)
1.56–6,25 3,13–12,5 0,78–1,56 0,78–1,56 0,78–1,56 0,05–0,2
(3,1128) (1,56 / 1,56) (1,56 / 1,56) (1,56 / 1,56) (0,1 / 0,2)

MIC (мкг мл -1 ) Относительная скорость оттока EB AF BK CH NFLX OFLX NA Бесплатно 6,25 50 12,5 0,78

.1 <0,1 50 1 pTZ244 ( norA23 ) 800 > 800 100 6,25 6,25 400 pTZ261 ( norA ) 400 400 25 6,25 3,13 0,2 100 2,03 ± 0,43 *

ген МИК (мкг мл -1 ) Относительная скорость оттока AF EB BK CH NFLX OFLX NA 6.25 50 12,5 0,78 <0,1 <0,1 50 1 pTZ244 ( norA23 ) 80012 100128 80012 100128 6,28

> 0,39 400 5,35 ± 1,49 * pTZ261 ( norA ) 400 400 25 6,25 3,13 0,128

2 100 2,03 ± 0,43 *

4

МИК для E. coli JM109, несущих norA23 , и относительная скорость оттока EB

932 мкг / мл

932 мкг −1 )

бесплатно.25

2

Плазмида (ген) МИК (ген) Относительная скорость оттока
AF EB BK CH NFLX OFLX NA
50 12,5 0,78 <0,1 <0,1 50 1
pTZ244 ( norA23 ) 80012 100128 80012 100128 6,28

> 0,39 400 5,35 ± 1,49 *
pTZ261 ( norA ) 400 400 25 6,25 3,13 0,128 100 2,03 ± 0,43 *

.1

, по крайней мере, четыре наших антиптикона

гены устойчивости, включая qacA и smr , могут быть идентифицированы в MRSA.Наши результаты также показали, что устойчивые к антисептикам штаммы MRSA без генов qacA и smr уже получили широкое распространение в Японии.

4 Обсуждение

В настоящем исследовании мы изучили чувствительность к антисептикам и распределение генов устойчивости к антисептикам у MRSA, выделенного в Японии в 1992 году. Хотя устойчивый к антисептикам MRSA (72%) уже широко распространен в Японии, частота генов qacA и smr у этих штаммов составляло всего 10 и 20% соответственно.Результаты экспериментов были подтверждены с помощью ПЦР с очищенной ДНК, поскольку частота обнаружения гена smr с помощью ПЦР была выше, чем при гибридизации по Саузерну. Кроме того, штаммы, несущие smr , показали широкий диапазон МИК (25-200 мкг / мл -1 ) EB по сравнению с ранее опубликованными данными МИК (20-50 мкг / мл -1 ) для smr [1 , 9, 12]. Когда мы провели гибридизацию smr и трансформацию плазмидой с использованием нескольких штаммов, которые несли smr и демонстрировали высокий уровень устойчивости к AF (MIC: 400 мкг / мл -1 ), все трансформанты показали примерно одинаковые значения MIC. EB в качестве исходных штаммов и содержал 2.Плазмида размером 4 т.п.н., гибридизованная с геном smr . Однако МИК AF для нескольких трансформантов (50–400 мкг / мл -1 ) отличались от таковых для исходных штаммов. Эти результаты предполагают появление smr , который выражает высокий уровень устойчивости к EB и наличие второй детерминанты устойчивости к антисептикам. Механизм повышенной устойчивости к EB, опосредованной smr , и идентификация второй детерминанты устойчивости в настоящее время исследуются в наших лабораториях.

В устойчивом к антисептике MRSA ( n = 71), идентифицированном в настоящем исследовании, 41 штамм (58%) не нес ни qacA , ни smr . Основным открытием настоящего исследования было клонирование хромосомного гена norA23 из штамма MRSA, который проявлял высокий уровень устойчивости к AF. Предыдущие исследования показали, что повышенная устойчивость к фторхинолонам, опосредованная norA , обусловлена ​​мутациями, вызывающими сверхэкспрессию norA [15, 16].Однако мутации, которые вызывают устойчивость к антисептикам и NFLX на или A23 , не могут быть идентифицированы в настоящем исследовании. Это было связано с отсутствием мутации norA23 в сайте мутации norA и norA1199 [15, 16], а также тем, что norA23 показал много различий не только в последовательностях ДНК norA и norA1199. , но и выведенные аминокислотные последовательности (рис. 1). Почему norA23 увеличил устойчивость к антисептикам, станет предметом будущего исследования.Кроме того, хотя три гена устойчивости к фторхинолонам, norA, grlA и gyrA , были идентифицированы у S. aureus [17], мутация norA придает устойчивость к NFLX, но не к спарфлоксацину (SPFX) [ 14, 15]. Семь (37%) из 19 штаммов, которые предположительно были мутантами norA , были чувствительны к SPFX. Результаты подтверждают мнение о том, что устойчивость к AF и NFLX семи штаммов обусловлена ​​мутацией norA и что другие 12 штаммов, которые демонстрируют высокий уровень устойчивости к NFLX, по-видимому, страдают не только или A , но и . grlA и / или gyrA образуют мутации.Кроме того, ParC, кодируемый grlA , по-видимому, является основной мишенью фторхинолонов в S. aureus , а мутант grlA был впервые получен путем одноэтапной селекции фторхинолонов [17]. Следовательно, кажется вероятным, что мутация norA может появиться под давлением отбора антисептиков и дезинфицирующих средств, а не под давлением отбора фторхинолонов.

С другой стороны, в оставшихся штаммах с низким уровнем устойчивости без qacA и smr , хотя мы попытались передать устойчивость к антисептикам в S.aureus конъюгацией и / или трансформацией плазмидами не было получено ни трансформанта, ни трансконъюганта. Эти результаты предполагают, что ген, связанный с устойчивостью к антисептикам, расположен на хромосоме S. aureus , и мутация его гена может повысить устойчивость к антисептикам, как это было в случае с norA [15, 16].

Хотя большинство генов устойчивости к антисептикам в S. aureus , которые были протестированы до 1990 г., были обнаружены на плазмидах [1, 2], наше исследование показывает, что устойчивые к антисептикам штаммы, обусловленные другими генами, предположительно на хромосоме S .aureus , например norA , широко распространены по всей Японии.

Благодарности

Мы благодарны доктору Р. Новику за предоставление штаммов RN S. aureus . Мы также благодарим Н. Табара, С. Секизука, М. Сэйта и М. Ошита за их техническую помощь. Эта работа была частично поддержана грантом Министерства здравоохранения и социального обеспечения и другим грантом Корпорации поощрения и взаимопомощи для частных школ Японии.

Список литературы

[1]

(

1986

)

Выделение и характеристика семейства малых плазмид, кодирующих устойчивость к соединениям, связывающим нуклеиновые кислоты, у Staphylococcus aureus

.

J. Med. Microbiol.

22

,

9

15

. [2]

(

1986

)

Закодированная плазмидой устойчивость к акрифлавину и четвертичным аммониевым соединениям у метициллин-резистентных Staphylococcus aureus

.

FEMS Microbiol. Lett.

34

,

47

51

. [3]

(

1990

)

Антисептический ген, опосредованный оттоком qacA из Staphylococcus aureus : общий предок с тетрациклиновыми и транспортными белками сахара

.

Мол. Microbiol.

4

,

2051

2062

. [4]

(

1996

)

Белки множественной лекарственной устойчивости QacA и QacB из Staphylococcus aureus : топология мембраны и идентификация остатков, участвующих в субстратной специфичности

.

Proc. Natl. Акад. Sci. США

93

,

3630

3635

. [5]

(

1991

)

Структура и эволюция семейства генов, кодирующих устойчивость к антисептикам и дезинфицирующим средствам у Staphylococcus aureus

.

Ген

101

,

59

66

. [6]

(

1989

)

Нуклеотидная последовательность гена, кодирующего устойчивость к бромистому этидию из переносимой плазмиды в Staphylococcus aureus

.

Nucleic Acids Res.

17

,

10103

. [7]

(

1992

)

Продукт гена множественной лекарственной устойчивости стафилококков является членом нового семейства белков

.

Плазмида

27

,

119

129

. [8]

(

1996

)

Протонзависимые системы множественного оттока лекарств

.

Microbiol. Ред.

60

,

575

608

. [9]

(

1994

)

Множественная лекарственная устойчивость к антисептикам и дезинфицирующим средствам у коагулазонегативных стафилококков

.

J. Med. Microbiol.

40

,

214

220

. [10]

(

1983

)

Самотрансмиссивные плазмиды в стафилококках, которые кодируют устойчивость к аминогликозидам

.

Антимикробный. Агенты Chemother.

24

,

70

77

. [11]

(

1976

)

Ассоциация гена устойчивости к пенициллину с плазмидой устойчивости к тетрациклину (pTP-2) в Staphylococcus aureus

.

Антимикробный. Агенты Chemother.

9

,

706

712

. [12]

(

1992

)

Высокая устойчивость к бромистому этидию и антисептикам у Staphylococcus aureus

.

FEMS Microbiol. Lett.

93

,

109

114

. [13]

(

1985

)

Аутогенная регуляция синтеза белка репликации в плазмиде pSC101

.

Мол. Genet Genet.

200

,

362

367

. [14]

(

1990

)

Нуклеотидная последовательность и характеристика гена Staphylococcus aureus norA , который придает устойчивость к хинолонам

.

J. Bacteriol.

172

,

6942

6949

. [15]

(

1994

)

Устойчивость к хинолонам, опосредованная norA : физиологическая характеристика и связь с flqB , локусом устойчивости к хинолонам на хромосоме Staphylococcus aureus

.

Антимикробный. Агенты Chemother.

38

,

1345

1355

. [16]

(

1993

)

Опосредованная оттоком резистентность к фторхинолонам у Staphylococcus aureus

.

Антимикробный. Агенты Chemother.

37

,

1086

1094

. [17]

(

1995

)

Анализ мутации gyrA и grlA в ступенчато отобранном устойчивом к ципрофлоксацину мутанте Staphylococcus aureus

.

Антимикробный. Агенты Chemother.

39

,

1554

1558

.

© 1999 Федерация европейских микробиологических обществ. Опубликовано Elsevier Science B.V. Все права защищены.

Организация гена антисептической устойчивости qacA и генов β-лактамаз, связанных с Tn552, в штаммах Staphylococcus haemolyticus животного и человеческого происхождения с множественной лекарственной устойчивостью

Антимикробные агенты Chemother. 2002 ноя; 46 (11): 3606–3612.

И.-Л. Антонисен

Кафедра фармакологии, микробиологии и гигиены пищевых продуктов, Норвежская школа ветеринарных наук, 0033 Осло, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

М. Сунде

Департамент фармакологии, микробиологии и гигиены пищевых продуктов, Норвежская школа ветеринарии, 0033 Осло, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

T.M. Steinum

Кафедра фармакологии, микробиологии и гигиены пищевых продуктов, Норвежская школа ветеринарных наук, 0033 Осло, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

MS Sidhu

Департамент фармакологии, микробиологии и гигиены пищевых продуктов, Норвежская школа ветеринарии, 0033 Осло, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

H. Sørum

Департамент фармакологии, Микробиология и гигиена пищевых продуктов, Норвежская школа ветеринарных наук, 0033 Осло, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

Кафедра фармакологии, микробиологии и пищевой гигиены Норвежской школы of Veterinary Science, 0033 Oslo, 1 MATFORSK, Норвежский научно-исследовательский институт пищевых продуктов, N-1430 Ås, Норвегия 2

* Автор, ответственный за переписку.Почтовый адрес: Департамент фармакологии, микробиологии и гигиены пищевых продуктов, Норвежская школа ветеринарии, почтовый ящик 8146 Dep., 0033 Осло, Норвегия, телефон: 4722597030. Факс: 4722964818. Электронная почта: [email protected] .

Поступило 7 января 2002 г .; Пересмотрено 20 мая 2002 г .; Принято 27 июля 2002 г.

Copyright © 2002, Американское общество микробиологов. Эта статья цитируется в других статьях в PMC.

Abstract

Часть (12 т.п.н.) плазмиды, содержащей гены β-лактамаз Tn 552 , ген устойчивости к дезинфицирующим средствам qacA и фланкирующую ДНК, была клонирована из изолята Staphylococcus haemolyticus и секвенирована.Эта область была использована для картирования соответствующих областей в шести других мультирезистентных изолятах S. haemolyticus человеческого и животного происхождения. Организация генетических структур у всех изученных изолятов была практически идентична. Гены β-лактамазы и qacA из S. haemolyticus имеют> 99,9% идентичности на уровне нуклеотидов с теми же генами из S. aureus , демонстрируя, что различные виды стафилококков, способные колонизировать животных и человека-хозяев, могут обмениваться генетические элементы, участвующие в устойчивости к антибиотикам и дезинфицирующим средствам.Использование антибиотиков и дезинфицирующих средств в ветеринарной практике и животноводстве также может способствовать отбору и поддержанию факторов устойчивости среди видов стафилококков. Различные части проанализированного участка размером 12 т.п.н. имели высокую степень нуклеотидной идентичности с областями из нескольких других плазмид Staphylococcus aureus . Это предполагает вклад межплазмидной рекомбинации в эволюционный состав этого участка размером 12 т.п.н., включающего плазмиды, которые могут смешиваться между различными видами стафилококков.Латеральному распространению генов устойчивости между различными видами стафилококков, вероятно, способствует генерация больших плазмид мультирезистентности и последующий межвидовой обмен ими.

Коагулазонегативные стафилококки (CoNS) традиционно считались непатогенными комменсалами. В последние годы бактерии этой группы все чаще признаются важными патогенами, вызывающими заболевания как у животных, так и у людей (1, 7, 26). Коагулазонегативный кожный комменсал Staphylococcus haemolyticus был связан с различными инфекциями у людей, и эти инфекции особенно поражают людей с нарушенной защитой хозяина и людей с имплантированными инородными телами (7, 20).Обнаружение S. haemolyticus в случаях инфекции молочной железы крупного рогатого скота не является чем-то необычным (1, 10, 11), а бактерия связана с инфекцией мочевыводящих путей собак (26).

Устойчивость к нескольким антимикробным препаратам часто обнаруживается среди клинических изолятов S. haemolyticus (32). Помимо того, что он является потенциальным патогеном, мультирезистентный S. haemolyticus , возможно, также может служить донором генов устойчивости для более вирулентных стафилококков, таких как коагулаза-положительный Staphylococcus aureus и Staphylococcus intermediateus. Обнаружение близкородственных плазмид и элементов устойчивости среди бактерий в группе стафилококков предполагает, что произошел горизонтальный перенос генов (28).

Производство β-лактамазы — один из механизмов, с помощью которого стафилококки становятся устойчивыми к β-лактамным антибиотикам. Ген β-лактамазы blaZ и два связанных гена, контролирующих его экспрессию, blaI и blaR , были идентифицированы на нескольких различных транспозонах (15, 23).Транспозон Tn 552 содержит три гена, участвующих в продукции β-лактамаз, и они составляют правую половину транспозона (генный модуль Tn 552 bla ). Левая половина Tn 552 (модуль мобильности) содержит гены p480 , которые кодируют транспозазу; p271 , который кодирует потенциальный АТФ-связывающий белок; binL , который кодирует рекомбиназу; и сайт разрешения, resL . Tn 552 фланкирован инвертированными концевыми повторами длиной 116 п.н. (TIR L и TIR R ) (23, 24).Присутствие интактных транспозонов и элементов инсерционной последовательности (IS) может приводить к множеству генетических перестроек, включая делеции, инверсии и транслокации. Структура природных стафилококковых плазмид указывает на то, что в ходе эволюции произошло множество крупномасштабных перестроек с участием генов β-лактамаз (23).

Повышенная устойчивость к дезинфицирующим средствам может быть вызвана энергозависимыми насосами оттока, расположенными в клеточной мембране (6, 12, 14, 16).Гены, кодирующие белки-экспортеры множества лекарственных препаратов среди стафилококков, можно разделить на два семейства на основе гомологии ДНК и фенотипических свойств (14, 18, 21). Члены семейства qacA qacB обладают более широким фенотипом устойчивости, чем члены семейства smr (13). Гены qacA и qacB тесно связаны и различаются на нуклеотидном уровне семью нуклеотидами. Изменение одной аминокислоты (Ala в qacB → Asp в qacA , кодон 323), вероятно, отвечает за различия в фенотипической экспрессии, что дает более широкий фенотип устойчивости у изолятов, несущих qacA (18, 19).

В этом исследовании мы исследовали организацию Tn 552 и производных транспозона на больших плазмидах S. haemolyticus , происходящих из животных и людей. Была определена нуклеотидная последовательность участка размером примерно 12 т.п.н., содержащего гены β-лактамаз, ген устойчивости к дезинфицирующим средствам и фланкирующую ДНК. Последовательность выровнена с соответствующими областями, обнаруженными в S. aureus .

МАТЕРИАЛЫ И МЕТОДЫ

Штаммы бактерий.

Всего в эту работу было включено семь полирезистентных штаммов S. haemolyticus . Четыре изолятов (изоляты NVH95A, NVH95B, NVH97A и NVH97B) были получены с полов клеток для животных в ветеринарной клинике для мелких животных. Эти изоляты принадлежали к определенному штамму, который сохранялся в клинике более 1 года, несмотря на точные процедуры мытья и дезинфекции (Х. Оппегаард, М. С. Сидху, Т. П. Девор и Х. Сорм, представлены для публикации).Кроме того, в исследование был включен один изолят (изолят NVH98) из раны кошки, госпитализированной в клинику для мелких животных. Для сравнения также были включены два изолята из разных источников. Один (изолят NVh507 / 97) произошел от молочной коровы с инфекцией молочной железы, а другой (изолят NVHRH) произошел от человека с сепсисом. Все изоляты были идентифицированы как S. haemolyticus с помощью набора StaphZym (Rosco Diagnostica, Тааструп, Дания).

Все изоляты, кроме изолята человеческого происхождения, ранее были подвергнуты тестированию на чувствительность (Oppegaard et al., Отправлено). Изоляты продуцировали β-лактамазу и проявляли устойчивость к широкому спектру антибактериальных агентов, таких как ампициллин, цефалексин, оксациллин, тетрациклин, триметоприм, сульфадиазин и стрептомицин. Изолят NVH95B также проявил устойчивость к гентамицину. Детерминанта mecA , ответственная за экспрессию устойчивости к метициллину, была обнаружена в изолятах (Oppegaard et al., Представлено).

Человеческий изолят (изолят NVHRH) был подвергнут тестированию на чувствительность в настоящем исследовании стандартным методом микроразведения и стандартным методом дисковой диффузии.Этот изолят проявлял устойчивость к тем же антимикробным соединениям, что и изолят NVH95B.

Определение МПК дезинфицирующих средств и бромистого этидия.

МИК бензалкония хлорида, хлоргексидина и бромида этидия определяли, как описано ранее (31). S. haemolyticus DSM 20623 был включен в качестве чувствительного контроля.

Выделение тотальной ДНК и плазмидной ДНК и лечение плазмид устойчивости pNVH97A и pNVH97B.

Тотальную ДНК и плазмидную ДНК экстрагировали с использованием набора для экстракции Easy-DNA и S.Набор N.A.P. Miniprep, соответственно, оба из которых были приобретены у Invitrogen Corp. (Гронинген, Нидерланды). Перед стадией лизиса стенки стафилококковых клеток разрушали обработкой лизостафином (Fluka Chemie, Buchs, Швейцария) в течение 90 минут при 37 ° C. Штаммы NVH97A и NVH97B были излечены от плазмид, придающих устойчивость к соединениям четвертичного аммония и бромиду этидия, с помощью новобиоцина (9). Эти штаммы обозначаются как NVH97A (излеченные) и NVH97B (излеченные) соответственно.

ПЦР.

ПЦР проводили для обнаружения генов blaZ , blaI , blaR и p480 , как описано ранее (5, 33). Ген устойчивости к дезинфицирующим средствам qacA / B был обнаружен с помощью ПЦР с праймерами, перечисленными в таблице. Условия цикла были следующими: денатурация ДНК при 95 ° C в течение 60 секунд и 30 циклов при 95 ° C в течение 60 секунд и 40 ° C в течение 30 секунд, а затем 72 ° C в течение 60 секунд. Набор для ПЦР GeneAmp XL (Perkin-Elmer Cetus Corp, Norwalk, Conn.) был использован для амплификации области ДНК между генами β-лактамаз и геном устойчивости к дезинфицирующим средствам qacA (ампликон bla-qac , полученный с праймерами blaI2R и qIII; см. рис.) и для амплификации области ДНК между qacA и стафилококковый вставной элемент IS 257 (ампликон qac-IS , полученный с праймерами qII и ISF; см. Рис.). Состав каждой 50-мкл смеси ПЦР соответствовал рекомендациям производителя, а условия циклов были следующими: денатурация ДНК при 93 ° C в течение 2 минут и 25 циклов при 93 ° C в течение 1 минуты, 45 или 47 ° C в течение 45 с и 70 ° C в течение 5 мин.После последнего цикла температуру поддерживали на уровне 72 ° C в течение 10 мин. Температуры отжига составляли 45 ° C с праймерами blaI2R и qIII и 47 ° C с праймерами qII и ISF.

Физическая карта области 12 т.п.н., анализируемой в этом исследовании, содержащей гены β-лактамаз (генный модуль Tn 552 bla ), ген антисептической устойчивости qacA и vga -подобную плазмиду, вставленную ниже orf2 . (A) Организация генов bla , qacA и окружающих генов в четырех штаммах, выделенных из окружающей среды ветеринарной клиники мелких животных, и в двух клинических изолятах от животных.(B) Организация генов bla , qacA и окружающих генов в клиническом изоляте человеческого происхождения. Жирные линии на рестрикционной карте вверху представляют границы двух клонированных фрагментов Hin cII pNVH97A. Заштрихованные гены представляют собой секвенированные области. pNVH97A (жирный шрифт) — единственная плазмида, из которой была полностью секвенирована область размером 12 т.п.н. Область секвенировали в четырех частях: два клона Hin cII, ампликон bla-qac размером 3 т.п.н. и ампликон qac-IS размером 4 т.п.н.Организация генов в остальных линиях животных и линии человека была основана на экспериментах по гибридизации (таблица), а также амплификации и секвенировании ампликонов bla-qac размером 3 и 5 т.п.н. соответственно.

ТАБЛИЦА 1.

Олигонуклеотиды, используемые в экспериментах ПЦР

Плазмида (ген) МИК (мкг мл -1 ) Относительная скорость оттока
EB

BK CH NFLX OFLX NA
Бесплатно 6,25 50 12,5 0,78 <0,1 50 1
pTZ244 ( norA23 ) 800 > 800 100 6,25 6,25 400
pTZ261 ( norA ) 400 400 25 6,25 3,13 0,2 100 2,03 ± 0,43 *

94 293 TTTAAATGGCGAATGGTGT

, «attrs»: {«text»: «AJ400722», «term_id»: «8574410», «term_text»: «AJ400722»}} AJ400722

Олигонуклеотид Праймерная последовательность (5 ‘→ 3’) Положение нуклеотида в опубликованной последовательности Номер доступа EMBL. Ссылка или источник
blaI F ATGTCTCGCAATTCTTCAA 3190-3208 в blaI {«type»: «entrez-нуклеотид»: «X527», text «attrs:» , «term_id»: «46754», «term_text»: «X52734»}} X52734 24
blaI R CTATGGCTGAATGGGAT 3520-3504 in blaI 76 entre- entre- 9000 {entre- 9000 {Entre- нуклеотид «,» attrs «: {» текст «:» X52734 «,» term_id «:» 46754 «,» term_text «:» X52734 «}} X52734 24
blaI 2R CAAAGAAATTGAAGAATTG 3216 в blaI {«type»: «entrez-nucleotide», «attrs»: {«text»: «X52734», «term_id»: «46754», «term_text»: «X52734»}} X52734 24
blaR F CATCTGATAAATGTGTAGC 3612-3630 in blaR {«type»: «entrez-nucleotide», «attrs»: {«text»: «X52734» «46754», «term_text»: «X52734»}} X52734 901 28

24
blaR R GGTATCTAACTCTTCTTGC 5177-5159 в blaR {«type»: «entrez-nucleotide», «attrs»: {«text»: » : «46754», «term_text»: «X52734»}} X52734 24
blaZ 2F GAGGCTTCAATGACATATAGTG 5741-5762 в blaZ «nucleus» : тип ядра attrs «: {» text «:» X52734 «,» term_id «:» 46754 «,» term_text «:» X52734 «}} X52734 24
blaZ 2R TCTATCTCATATCTAACTGG 5800-555a {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X52734», «term_id»: «46754», «term_text»: «X52734»}} X52734 24
p480 F GGGCAAGCAATCTTTATCAAGC 2244-2223 в p480 {«type»: «entrez-nucleotide», «attrs»: {«text»: «X52734», «term_id4id», «term_id» «term_text»: «X52734»}} X52734 24
p480 R CGTTTCTTGAGGTGAGTAACC 936-956 в p480 {«type»: «entrez-nucleotide», «attrs»: {«text»: «X52734», «term_id», «term_id» «term_text»: «X52734»}} X52734 24
qacA / BF GCTGCATTTATGACAATGTTTG 1692-1713 в qacA «тип» ядра: «тип» ядра » «text»: «X56628», «term_id»: «773395», «term_text»: «X56628»}} X56628 18
qacA / BR AATCCCACCTACTAAAGCAG 2321-26 q302 0

2321-2302 942 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X56628», «term_id»: «773395», «term_text»: «X56628»}} X56628 18
qII CTGCTTTAGTAGGTGGGATT 2302-2321 в qacA {«type»: «entrez-nucleotide», «attrs»: {«text»: «X56628», «term_id»: «773395»: «term_text», «term_text» «X56628»}} X56628 18
qIII 267-249 в qacR {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X56628», «term_id»: «773395», «term_text»: » X56628 «}} X56628 18
IS F CAACGAAGGTAGCAATGGC 46122-46140 в IS 257 {» type «:» entrez-nuclers «, {» type «:» entrez-nuclers «, {» AF051917 «,» term_id «:» 3676412 «,» term_text «:» AF051917 «}} AF051917 4
vga F ATTCTATTGTCGTTTCATGACG z 9500-9521″ тип ядра « z 9500-9521 ent Это исследование
vga R CCTCTCCCTTACTTTCGTTT5690 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AJ400722», «term_id»: «8574410», «term_text»: «AJ400722»}} AJ400722 Это исследование

Секвенированные продукты ПЦР оказались закрытыми. перед реакцией секвенирования с помощью набора для клонирования TOPO TA (Invitrogen) в соответствии с инструкциями производителя.Амплификация области ДНК между геном qacA и стафилококковым элементом вставки IS 257 дала ампликон размером приблизительно 4 т.п.н. (ампликон qac-IS ; см. Рис.), Который было трудно клонировать. Поэтому ампликон очищали с использованием набора для экстракции геля QIAquick (Qiagen GmbH, Hilden, Германия), и очищенную ДНК непосредственно использовали в качестве матрицы в реакциях секвенирования. Набор внутренних праймеров был сконструирован на основе полученных последовательностей, и эти праймеры (праймеры vga F и vga R) были использованы во вложенной ПЦР.Полученный ПЦР-ампликон размером 1,8 т.п.н. клонировали с использованием набора для клонирования TOPO TA, и вставку секвенировали стандартными процедурами.

Эксперименты по гибридизации.

Плазмидная ДНК и общая ДНК, расщепленная рестрикционными ферментами, из всех изолятов (а также двух изолятов, излеченных от их плазмид, придающих устойчивость к дезинфицирующим агентам), были перенесены на нейлоновые мембраны (Hybond N +; Amersham International, Little Chalfont, United Kingdom) Саузерн-блоттинг (25). В качестве рестрикционных ферментов использовали Hin cII, Hin dIII, Eco RI и Cla I от Gibco BRL (Gaithersburg, MD.). 22-мерный олигонуклеотидный зонд, специфичный для генов qacA и qacB , использовали в экспериментах по гибридизации, как описано в другом месте (8). Продукты ПЦР, амплифицированные с праймерами, специфичными для генов blaZ , blaR и blaI , были помечены in vitro [α- 32 P] dCTP (Amersham) с использованием набора для маркировки рандомизированной ДНК (Boehringer GmbH, Мангейм, Германия) и использовались в качестве зондов. Предварительную гибридизацию, гибридизацию и отмывки проводили при 65 ° C.Все предгибридизации проводили в течение 2 ч в 2 × SSC (1 × SSC — 0,15 M NaCl плюс 0,015 M цитрат натрия) -0,1% додецилсульфата натрия (SDS) -5 × растворе Денхардта с последующей гибридизацией в течение 18 часов в 2 × SSC-0,1% SDS-5 × раствор Денхардта с 10% сульфатом декстрана. Промывки проводили в 5 × SSC-0,1% SDS в течение 1 часа дважды, а затем в течение 30 минут дважды. Наконец, мембраны подвергали авторадиографической пленке (Kodak, Rochester, N.Y.) при -70 ° C.

Клонирование

фрагментов Hin cII, содержащих ген Tn 552 и qacA / B .

Тотальную ДНК из изолята NVH97A рестриктировали с помощью Hin cII, и разделение фрагментов ДНК проводили в 0,7% агарозе с низкой температурой плавления (Amersham). Фрагменты размером приблизительно от 4 до 6 т.п.н. вырезали из геля и лигировали в pUC18, расщепленную бактериальной щелочной фосфатазой Sma I (Pharmacia, Упсала, Швеция) в пластинах геля агарозы с низкой температурой плавления, как описано Sambrook. и другие. (25). Буфер ДНК-лигазы Т4 (5 ×) и ДНК-лигаза Т4 были приобретены у Gibco BRL.Смесь для лигирования использовали для трансформации электрокомпетентной Escherichia coli (ElectroMAX Dh20B; Gibco BRL) путем электропорации с помощью устройства Bio-Rad Gene Pulser. Один микролитр смеси для лигирования добавляли к 40 мкл клеток в кюветах диаметром 0,2 см (Bio-Rad). Использовались следующие параметры генератора импульсов Gene Pulser: напряжение 2,5 кВ; емкость 25 мкФ; и импульсный регулятор, 200 Ом. После однократного импульса к клеткам добавляли 1 мл супербульона (3% триптона, 2% дрожжевой экстракции, 1% морфолинпропансульфоновой кислоты [MOPS]) с последующей инкубацией при 37 ° C в течение 1 часа перед посевом клеток на Лурия-агар, содержащий 50 мкг ампициллина (Sigma Chemical Co., Сент-Луис, Миссури) на мл. Блоты колоний, содержащие ДНК трансформантов, получали, как описано в другом месте (25). Перед гибридизацией мембраны промывали 50 мМ Трис-HCl (pH 8) -1 мМ NaCl-1 мМ ЭДТА-0,01% SDS в течение 1 ч при 37 ° C с последующей предгибридизацией и гибридизацией, как описано ранее. Используемые зонды были помечены ампликонами qacA / B и blaI . Отбирали сильно гибридизующиеся колонии, выделяли плазмиды и плазмидную ДНК использовали в качестве матрицы в реакциях секвенирования.

Секвенирование нуклеотидов.

Нуклеотидные последовательности определяли с помощью набора для готовых реакций секвенирования цикла ABI Prism Big Dye Terminator (Perkin-Elmer, Осло, Норвегия) с синтетическими олигонуклеотидными праймерами (ходящий праймер) и / или прямым и обратным праймерами M13. Реакции секвенирования проводили на автоматическом секвенаторе Perkin-Elmer ABI Prism 377. Нуклеотидные последовательности анализировали с использованием программного пакета Sequencher (версия 3.0; Gene Codes Corporation, Ann Arbor, Mich.) и пакет программного обеспечения для анализа последовательностей GCG (версия 8; Genetics Computer Group, Мэдисон, Висконсин).

РЕЗУЛЬТАТЫ

МИК дезинфицирующих средств и бромистого этидия.

Штаммы, включенные в исследование, обладали пониженной чувствительностью к хлориду бензалкония, хлоргексидину и бромистому этидию с МИК ≥5, ≥1,5 и ≥300 мкг / мл соответственно. МИК тех же трех соединений для контрольного штамма составляли ≤1, ≤0,5 и ≤50 мкг / мл соответственно.

ПЦР и эксперименты по гибридизации.

Гены β-лактамазы blaZ , blaI и blaR были обнаружены с помощью ПЦР во всех изолятах. Ген транспозазы Tn 552 , p480 был обнаружен только в штамме человеческого происхождения (штамм NVHRH). ПЦР с праймерами, специфичными для гена устойчивости к дезинфицирующему средству qacA / B , дала ампликоны ожидаемого размера (628 п.н.) с матрицами, полученными из всех изолятов. Анализ последовательности ампликонов qacA / B показал, что ген qacA присутствует во всех изолятах.Гены qacA и β-лактамазы не были обнаружены в двух изолятах, излеченных от их плазмид, придающих устойчивость к соединениям четвертичного аммония и бромистому этидию.

Эксперименты по гибридизации

показали, что qacA и blaZ , blaI и blaR были локализованы на плазмиде размером приблизительно 45 т.п.н. во всех штаммах. Изоляты NVH97A (излеченные) и NVH97B (излеченные) не содержали плазмиды размером 45 т.п.н., и общая ДНК этих штаммов не гибридизовалась ни с одним из зондов, специфичных для генов β-лактамазы и qacA .

Все штаммы из ветеринарной клиники, штамм госпитализированной кошки и штамм молочной коровы имели идентичные образцы гибридизации, тогда как штамм человеческого происхождения имел отчетливый образец гибридизации. Это показано в таблице.

ТАБЛИЦА 2.

Обзор различных изолятов и их паттернов гибридизации после гибридизации общей ДНК с blaZ, blaR, blaI и qacA-qacB зондами a

NVHH

NVH, NVHB 9429 NVH, NVHB .5, 9, 5, 5.5

942 9936

RI, Hin cII, Cla I

Изолят (s ) Паттерн гибридизации (размер фрагмента [kb])


Ферменты
blaZ blaR blaI qacA-qacB
12, 9, 5, 5.5 12, 9, 5, 5.5 12, 5.5, 5, 9 Hin dIII, Eco RI, Hin cII , Cla I
NVHRH 4 + 1,7, 10, 5.5, 9 14, 10, 5.5, 9 14, 10, 5.5, 9 14, 5.5, 9, 23 Hin dIII, Eco RI, Hin cII, Cla I
NVH97A (отвержденный), NVH97B (отвержденный)

Генетическая организация генов β-лактамазы и

qacA в изоляте NVH97A.

Тотальную ДНК из изолята NVH97A (из клиники мелких животных) рестриктировали с помощью Hin cII и клонировали в pUC18. Нуклеотидные последовательности двух разных клонов, гибридизирующихся с blaI- и qacA / B -специфическими зондами, выявили следующую организацию вовлеченных генетических структур: производное Tn 552 , состоящее из модуля гена Tn 552 bla . (правая половина транспозона), был локализован рядом с сайтом разрешения ( resR ), за ним следовали ген резольвазы binR , открытая рамка считывания orf1 и ген, кодирующий рекомбиназу sin .Ген qacA был расположен ниже sin и фланкирован его регуляторным геном qacR и открытой рамкой считывания orf2 . Организация и содержание двух клонов Hin cII показаны на рис. Была проведена ПЦР с праймерами, гибридизирующимися с конкретными областями в пределах двух фрагментов Hin cII (данные не показаны), чтобы доказать, что два фрагмента были соединены. Был получен ампликон ожидаемого размера, который впоследствии секвенировали.

Обнаружение IS

257 , orfB и repX после qacA в изоляте NVH97A.

Стафилококковый вставной элемент IS 257 (22), как было обнаружено, расположен примерно в 4 т.п.н. от гена qacA и ниже его. Это было обнаружено с помощью XL-PCR (с праймерами qII и IS F), в результате чего был получен ампликон размером приблизительно 4 т.п.н. (ампликон qac-IS ). Секвенирование нуклеотидов показало, что гены orfB (3) и repX (3) расположены между IS 257 и orf2 , как показано на рис..

Картирование области

bla qacA и фланкирующая ДНК в остальных штаммах.

Три других штамма из клиники для животных (штаммы NVH95A, NVH95B и NVH97B), штамм от кошки (штамм NVH98) и штамм от молочной коровы (штамм NVh509 / 97) содержали участок размером 12 т.п.н., равный к описанному для pNVH97A (рис.). Эти результаты были основаны на результатах экспериментов по гибридизации (таблица) и амплификации областей между blaI и qacR (ампликон bla-qac ) и между qacA и IS 257 ( qac- IS ампликон) (рис.). Частично секвенировали ампликоны bla-qac из всех штаммов. Изолят человеческого происхождения (штамм NVHRH) содержал участок, почти идентичный таковому в других штаммах, за исключением наличия полной последовательности Tn 552 (рис.). Транспозон был вставлен с модулем мобильности (левая половина) рядом с sin , orf1 , qacR и qacA . Полученные данные были основаны на экспериментах по гибридизации (таблица) и амплификации ампликонов bla-qac и qac-IS (рис.). Полную нуклеотидную последовательность определяли для ампликона bla-qac из NVHRH.

Выравнивание последовательностей области

bla qacA в трех штаммах различного происхождения.

Полная нуклеотидная последовательность была также определена для области между blaI и qacR в штамме бычьего происхождения (путем секвенирования ампликона bla-qac ). Сравнение последовательности с соответствующими областями в штамме человеческого происхождения (штамм NVHRH) и в штамме NVH97A показало, что последовательности blaI , sin , orf1 и qacR (приблизительно 3 т.п.н.) были 100 % идентичны для всех трех штаммов.

Идентичность ДНК с

последовательностями S. aureus .

Гены β-лактамазы blaZ , blaR и blaI на pNVH97A показали очень высокие уровни идентичности на уровне нуклеотидов (идентичность кодирующих областей,> 99,9%) с генами β-лактамаз на S .aureus плазмиды pS1 (регистрационный номер EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X52734», «term_id»: «46754», «term_text»: «X52734»}} } X52734) и pI258 (регистрационный номер EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «M62650», «term_id»: «152964», «term_text»: «M62650»}} } M62650 [34]).Нуклеотидная последовательность предполагаемого гена, кодирующего рекомбиназу, sin , была на 100% идентична нуклеотидной последовательности генов sin на плазмиде pSK1 S. aureus (номер доступа EMBL {«type»: «entrez-нуклеотид») , «attrs»: {«text»: «L23109», «term_id»: «4«, «term_text»: «L23109»}} L23109 [17]) и pSR1 (инвентарный номер EMBL AF 167161). Нуклеотидная последовательность orf1 , расположенная между sin и qacR , была на 100% идентична таковой orf4 на pSR1 и orf на pSK1.Нуклеотидная последовательность гена qacR на pNVH97A была на 100% идентична таковой qacR на pSK1 (регистрационный номер EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X56628) «,» term_id «:» 773395 «,» term_text «:» X56628 «}} X56628 [21]) и qacR на pVRSA (регистрационный номер EMBL AP 003367 [12]). Нуклеотидная последовательность qacA из S. haemolyticus была на 100% идентична таковой qacA на pVRSA и на 99% идентична таковой qacA на pSK1.Нуклеотидная последовательность orf2 была на 100% идентична таковой SAVP033 на pVRSA, за исключением замены нуклеотида (положение 8505 в нашей последовательности), которая привела к открытой рамке считывания, которая на девять аминокислот короче. Первые 290 нуклеотидов orf2 были также на 100% идентичны нуклеотидной последовательности orf186 на плазмиде pSK156 S. aureus (номер доступа EMBL AF 053771).

Нуклеотидная последовательность repX на pNVH97A примерно на 88% идентична таковой repX на S.aureus плазмида pIP680 (регистрационный номер EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF117259», «term_id»: «66

«, «term_text»: «AF117259»}} AF117259 [3]). Плазмида pIP680 несет гены устойчивости к стрептограмину, а repX располагается рядом с предполагаемой открытой рамкой считывания orfB и геном vga , который кодирует АТФ-связывающий белок (рис.) (3). Нуклеотидные последовательности генов на pNVH97A в некоторой степени отличаются от таковых в соответствующей области на pIP680: гомология между первыми 170 аминокислотами двух генов orfB является значительной.Однако следующие 20 аминокислот сильно различаются между двумя генами orfB . Кодирующая область orfB на pIP680 заканчивается там, тогда как orfB на pNVH97A кодирует еще 55 аминокислот. На pNVH97A последовательность длиной приблизительно 100 п.н., идентичная последовательности области перед кодирующей областью гена vga , была обнаружена ниже orfB , тогда как остальная часть гена vga отсутствовала.

Сравнение последовательности pNVH97A размером примерно 12 т.п.н. с другими известными плазмидными последовательностями (представлены тонкими линиями).Серые прямоугольники представляют собой области с высоким уровнем идентичности последовательностей (от примерно 90% для прямоугольников светло-серого до более 98% для темно-серых прямоугольников), стрелки в IS 256 и IS 257 обозначают направления соответствующие транспозазы, а более широкие стрелки обозначают разные гены и направления этих генов. Источники: pIP680, инвентарный номер EMBL. {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AF117259», «term_id»: «66

«, «term_text»: «AF117259»}} AF117259; pS1, инвентарный номер EMBL{«type»: «entrez-нуклеотид», «attrs»: {«text»: «X52734», «term_id»: «46754», «term_text»: «X52734»}} X52734; pVRSA, регистрационный номер EMBL {«type»: «entrez-нуклеотид», «attrs»: {«text»: «AP003367», «term_id»: «14020884», «term_text»: «AP003367»}} AP003367; pSK1, инвентарные номера EMBL. {«type»: «entrez-нуклеотид», «attrs»: {«text»: «X56628», «term_id»: «773395», «term_text»: «X56628»}} X56628 и {«type»: «entrez -nucleotide «,» attrs «: {» text «:» L23109 «,» term_id «:» 4 «,» term_text «:» L23109 «}} L23109.

Наше исследование показывает, что некоторые участки в пределах области 12 т.п.н., которые мы проанализировали, имеют высокую степень идентичности на уровне нуклеотидов с участками из нескольких других S.aureus плазмиды. Это показано на рис.

ОБСУЖДЕНИЕ

Штаммы, включенные в это исследование, происходили из разных источников и из отдаленных географических областей, и было обнаружено, что все штаммы несут плазмиду размером 45 т.п.н. с областью размером 12 т.п.н., содержащей кластер детерминант устойчивости. Организация генетических структур в этом регионе была практически идентична у всех штаммов. Нуклеотидные последовательности части blaI , sin , orf1 и qacR (составляющие 3 т.п.н.) у штаммов из клиники мелких животных (штамм NVH97A), молочной коровы (штамм NVh507 / 97), и человек (штамм NVHRH) были на 100% идентичны при выравнивании.Это говорит о том, что эти гены связаны и, вероятно, имеют недавнее общее происхождение. Исследования, недавно проведенные Oppegaard et al. (представлен) показали, что штаммы животного происхождения были тесно связаны и, возможно, представляют собой клональные производные. Человеческий штамм отличался от других изолятов и, таким образом, представлял другой клон. Тот факт, что нуклеотидные последовательности различных клонов S. haemolyticus были на 100% идентичны, предполагает, что горизонтальный перенос ДНК мог происходить между этими клонами и между штаммами, способными колонизировать человека и животных-хозяев.Использование антибиотиков и дезинфицирующих средств в ветеринарной практике и животноводстве также может способствовать отбору и поддержанию факторов устойчивости среди различных видов стафилококков.

Было высказано предположение, что большие стафилококковые плазмиды с множественной резистентностью развивались путем коинтеграции более мелких плазмид резистентности в уже существующую конъюгативную плазмиду (4, 29). Вставной элемент стафилококка IS 257 играет центральную роль в таких событиях коинтеграции.Большая конъюгированная плазмида pSK41 интегрировала несколько небольших плазмид, и все коинтегрированные плазмиды внутри pSK41 фланкированы копиями IS 257 (4). Стафилококковые плазмиды, несущие три гена устойчивости к стрептограмину, vat , vgb и vga (2), были обнаружены у штаммов стафилококков, принадлежащих к трем разным таксонам (3). Все эти плазмиды устойчивости к стрептограмину имели общий фрагмент размером 12,1 т.п.н., несущий три гена, участвующих в обеспечении устойчивости к стрептограмину.Предполагается, что создание этой области размером 12,1 т.п.н. является результатом совместной интеграции двух меньших плазмид, в которых одна из плазмид-предшественников была функциональной плазмидой vga (рис.) (3). Мы идентифицировали в наших штаммах участок плазмиды, который в значительной степени соответствует части плазмиды vga -подобной. Эти данные предполагают, что коинтеграция vga -подобной плазмиды могла иметь место ниже orf2 на больших плазмидах S. haemolyticus , описанных в этом исследовании.Отсутствие гена vga , за исключением участка длиной 100 п.н. перед кодирующей областью, подтверждает теорию о том, что в этой области произошло событие реаранжировки. Кроме того, orf2 имеет 100% идентичность последовательности с SAVP033 на pVRSA, за исключением того, что orf2 на девять аминокислот короче, чем SAV033, что подтверждает, что рекомбинация имела место в пределах области.

Наличие больших плазмид, на которых гены Tn 552 bla и гены binR и sin организованы аналогично тому, как они организованы на S.aureus плазмиды pI258 и pI1066 (5) продемонстрированы в S. haemolyticus (рис.). Это предполагает, что эти генетические структуры имеют общую организацию и что большие плазмиды, содержащие их, широко распространены среди различных видов стафилококков. Ген qacA ранее был обнаружен среди CoNS (13) и среди изолятов S. aureu s, включая метициллин-устойчивые изоляты S. aureus (6, 12, 14, 16, 18, 21, 27, 28). ). Локализация генов qacA / B в тесной ассоциации с транспозонами β-лактамаз кажется обычным явлением, поскольку это было обнаружено на нескольких S.aureus плазмиды. Мы показали, что такая организация присутствует и в CoNS.

Гены β-лактамазы и qacA из S. haemolyticus имеют> 99,9% идентичности на нуклеотидном уровне с теми же генами из S. aureus , что указывает на то, что различные виды стафилококков способны колонизировать как животных, так и животных. человеческие хозяева могут обмениваться генетическими элементами, участвующими в устойчивости к антибиотикам и дезинфицирующим средствам.

Выбор комменсалов с множественной устойчивостью имеет решающее значение, поскольку такие бактерии могут представлять собой резервуар генов устойчивости, которые могут передаваться другим бактериям.Это исследование демонстрирует существование мультирезистентных комменсалов, содержащих детерминанты устойчивости, идентичные тем, которые обнаружены в клинических изолятах S. aureus , тем самым демонстрируя, что стафилококковые комменсалы можно рассматривать как резервуар генов устойчивости. Поразительное сходство между последовательностями ДНК из S. haemolyticus и метициллин-устойчивого штамма S. aureus с устойчивостью к ванкомицину (pVRSA на рис.) (12) подтверждает теорию о том, что CoNS способствовали факторам устойчивости к созданию высокоэффективных стойкий С.aureus .

Фрагмент размером 12 т.п.н., анализируемый в этой работе, демонстрирует замечательную кластеризацию как интактных, так и частичных детерминант устойчивости в ограниченной области. Различные области в этом участке размером 12 т.п.н. имеют высокую степень идентичности нуклеотидной последовательности с участками из нескольких других плазмид S. aureus , как показано на фиг. Это предполагает вклад межплазмидной рекомбинации в эволюционный состав этого участка размером 12 т.п.н., включающего плазмиды, которые могут смешиваться между различными видами стафилококков.

Благодарности

Мы благодарны Эгилу Лингаасу, Рикшоспиталет, Осло, Норвегия, за пожертвование штамма NVHRH.

Работа частично поддержана грантом Норвежского исследовательского совета (грант 117131/112).

СПИСОК ЛИТЕРАТУРЫ

1. Aarestrup, F. M., H. C. Wegener, V. T. Rosdahl, and N. E. Jensen. 1995. Стафилококки и другие виды бактерий, ассоциированные с интрамаммарными инфекциями в датских молочных стадах. Acta Vet. Сканд. 36 : 475-487.[Бесплатная статья PMC] [PubMed] [Google Scholar] 2. Allignet, J., S. Aubert, A. Morvan, and N. El Solh. 1996. Распределение генов, кодирующих устойчивость к стрептограмину А и родственным соединениям, среди стафилококков, устойчивых к этим антибиотикам. Противомикробный. Агенты Chemother. 40 : 2523-2528. [Бесплатная статья PMC] [PubMed] [Google Scholar] 3. Allignet, J., and N. El Solh. 1999. Сравнительный анализ стафилококковых плазмид, несущих гены устойчивости к стрептограмину. Плазмида 42 : 134-138.[PubMed] [Google Scholar] 4. Берг Т., Н. Ферт, С. Аписиридей, А. Хеттиаратчи, А. Лилапорн и Р. А. Скуррей. 1998. Полная нуклеотидная последовательность pSK41: эволюция стафилококковых конъюгативных плазмид с множественной резистентностью. J. Bacteriol. 180 : 4350-4359. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Дербиз А., К. Г. Х. Дайк и Н. Эль-Сол. 1995. Перестройки в плазмиде pIP1066, кодирующей стафилококковую β-лактамазу, включая инверсию ДНК, которая генерирует два альтернативных транспозона.Мол. Microbiol. 17 : 769-779. [PubMed] [Google Scholar] 6. Гиллеспи, М. Т., Дж. У. Мэй и Р. А. Скуррей. 1986. Закодированная плазмидой устойчивость к акрифлавину и четвертичным аммониевым соединениям у метициллин-устойчивого Staphylococcus aureus . FEMS Microbiol. Lett. 34 : 47-51. [Google Scholar] 7. Gunn, B.A. 1989. Сравнительная вирулентность человеческих изолятов коагулазонегативных стафилококков, испытанных на модели замедления веса новорожденных мышей.J. Clin. Microbiol. 27 : 507-511. [Бесплатная статья PMC] [PubMed] [Google Scholar] 8. Heir, E., G. Sundheim, and A. L. Holck. 1995. Устойчивость к соединениям четвертичного аммония у Staphylococcus spp. выделен из пищевой промышленности и нуклеотидной последовательности плазмиды устойчивости pST827. J. Appl. Бактериол. 79 : 149-156. [PubMed] [Google Scholar] 9. Heir, E., G. Sundheim, and A. Holck. 1998. Продукт гена Staphylococcus qacH : новый член семейства SMR, кодирующих множественную лекарственную устойчивость.FEMS Microbiol. Lett. 163 : 49-56. [PubMed] [Google Scholar] 10. Jarp, J. 1991. Классификация коагулазонегативных стафилококков, выделенных из клинических и субклинических маститов крупного рогатого скота. Вет. Microbiol. 27 : 151-158. [PubMed] [Google Scholar]

11. Йонссон, П. и Т. Вадстрём. 1993. Staphylococcus, p. 21-35. В К. Л. Гайлз и К. О. Тоен (ред.), Патогенез бактериальных инфекций у животных, 2-е изд. Издательство государственного университета Айовы, Эймс.

12. Курода, М., Т. Охта, И. Учияма, Т. Баба, Х. Юдзава, И. Кобаяси, Л. Цуй, А. Огучи, К. Аоки, Ю. Нагаи, Дж. Лян, Т. Ито, М. Канамори, Х. Мацумару, А. Маруяма, Х. Мураками, А. Хосояма, Ю. Мизутани-Уи, Н. Кобаяси, Т. Савано, Р. Иноуэ, К. Кайто, К. Секимидзу, Х. . Хиракава, С. Кухара, С. Гото, Дж. Ябузаки, М. Канехиса, А. Ямасита, К. Осима, К. Фуруя, К. Йошино, Т. Шиба, М. Хаттори, Н. Огасавара, Х. Хаяси , и К. Хирамацу. 2001. Секвенирование всего генома метициллин-устойчивого Staphylococcus aureus .Ланцет 357 : 1225-1240. [PubMed] [Google Scholar] 13. Лилапорн А., И. Т. Паулсен, Дж. М. Теннент, Т. Г. Литтлджон и Р. А. Скуррей. 1994. Множественная лекарственная устойчивость к антисептикам и дезинфицирующим средствам у коагулазонегативных стафилококков. J. Med. Microbiol. 40 : 214-220. [PubMed] [Google Scholar] 14. Литтлджон, Т. Г., И. Т. Полсен, М. Т. Гиллеспи, Дж. М. Теннент, М. Мидгли, И. Г. Джонс, А. С. Пурувал и Р. А. Скуррей. 1992. Субстратная специфичность и энергетика устойчивости к антисептическим и дезинфицирующим средствам у Staphylococcus aureus .FEMS Microbiol. Lett. 74 : 259-266. [PubMed] [Google Scholar] 16. Noguchi, N., M. Hase, M. Kitta, M. Sasatsu, K. Deguchi, and M. Kono. 1999. Антисептическая чувствительность и распределение генов устойчивости к антисептикам у метициллин-устойчивого Staphylococcus aureus . FEMS Microbiol. Lett. 172 : 247-253. [PubMed] [Google Scholar] 17. Паулсен, И. Т., М. Т. Гиллеспи, Т. Г. Литтлджон, О. Ханвиватвонг, С.-Дж. Роуленд, К. Г. Х. Дайк и Р. А. Скуррей. 1994. Характеристика sin , потенциального гена, кодирующего рекомбиназу, из Staphylococcus aureus . Gene 141 : 109-114. [PubMed] [Google Scholar] 18. Паулсен, И. Т., М. Х. Браун, Т. Г. Литтлджон, Б. А. Митчелл и Р. А. Скуррей. 1996. Белки множественной лекарственной устойчивости QacA и QacB из Staphylococcus aureus : топология мембраны и идентификация остатков, участвующих в субстратной специфичности. Proc. Natl. Акад. Sci. США 93 : 3630-3635.[Бесплатная статья PMC] [PubMed] [Google Scholar] 19. Паулсен, И. Т., М. Х. Браун и Р. А. Скуррей. 1998. Характеристика самой ранней известной плазмиды Staphylococcus aureus , кодирующей систему оттока множества лекарственных препаратов. J. Bacteriol. 180 : 3477-3479. [Бесплатная статья PMC] [PubMed] [Google Scholar] 20. Peters, G. 1988. Новые соображения в патогенезе коагулазонегативных стафилококковых инфекций инородных тел. J. Antimicrob. Chemother. 21 (Дополнение C) : 139–148.[PubMed] [Google Scholar] 21. Руш, Д. А., Д. С. Крам, Д. ДиБерардино, Т. Г. Литтлджон и Р. А. Скуррей. 1990. Опосредованный оттоком ген устойчивости к антисептикам qacA из Staphylococcus aureus : общий предок с тетрациклиновыми и транспортными белками сахара. Мол. Microbiol. 4 : 2051-2062. [PubMed] [Google Scholar] 22. Руш, Д. А. и Р. А. Скуррей. 1989. IS 257 из Staphylococcus aureus : член суперсемейства инсерционной последовательности, преобладающего среди грамположительных и грамотрицательных бактерий.Ген 76 : 195-205. [PubMed] [Google Scholar] 23. Роуленд, С.-Дж., и К.Г. Х. Дайк. 1989. Характеристика транспозона стафилококковой β-лактамазы Tn 552 . EMBO J. 8 : 2761-2773. [Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Роуленд, С.-Дж., и К.Г. Х. Дайк. 1990. Tn 552 , новый мобильный элемент из золотистого стафилококка. Мол. Microbiol. 4 : 961-975. [PubMed] [Google Scholar]

25. Sambrook, J., E. F. Fritsch, T. Maniatis. 1989. Молекулярное клонирование: лабораторное руководство, 2-е изд. Лабораторная пресса Колд-Спринг-Харбор, Колд-Спринг-Харбор, Нью-Йорк,

26. Шварц С. и М. Кардосо. 1991. Молекулярное клонирование, очистка и свойства кодируемой плазмидой хлорамфениколацетилтрансферазы из Staphylococcus haemolyticus . Противомикробный. Агенты Chemother. 35 : 1277-1283. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Скуррей, Р.А., Д. А. Руш, Б. Р. Лайон, М. Т. Гиллеспи, Дж. М. Теннент, М. Э. Бирн, Л. Дж. Мессеротти и Дж. У. Мэй. 1988. Мультирезистентный Staphylococcus aureus : генетика и эволюция эпидемических австралийских штаммов. J. Antimicrob. Chemother. 21 (Дополнение C) : 19-39. [PubMed] [Google Scholar] 28. Skurray, R.A., and N. Firth. 1997. Молекулярная эволюция стафилококков с множественной устойчивостью к антибиотикам. Обнаружена Ciba. Symp. 207 : 167-183. [PubMed] [Google Scholar] 29. Сохаил М. и К. Г. Х. Дайк. 1995. Сайты для совместной интеграции больших плазмид стафилококков. Ген 162 : 63-68. [PubMed] [Google Scholar] 30. Сонг, М. Д., М. Вачи, М. Дои, Ф. Ишино и М. Мацухаши. 1987. Эволюция индуцируемого пенициллин-целевого белка в метициллин-устойчивом Staphylococcus aureus путем слияния генов. FEBS Lett. 221 : 167-171. [PubMed] [Google Scholar] 31. Sundheim, G., T. Hagtvedt и R. Dainty. 1992.Устойчивость стафилококков, ассоциированных с мясом, к соединениям четвертичного аммония. Food Microbiol. 9 : 161–167. [Google Scholar] 32. Tabe, Y., A. Nakamura, T. Oguri, and J. Igari. 1998. Молекулярная характеристика полирезистентных изолятов Staphylococcus haemolyticus . Диаг. Microbiol. Заразить. Дис. 32 : 177-183. [PubMed] [Google Scholar] 33. Томайко, Дж. Ф., К. К. Зчек, К. В. Сингх и Б. Э. Мюррей. 1996. Сравнение кластера генов β-лактамаз в клонально различных штаммах Enterococcus faecalis .Противомикробный. Агенты Chemother. 40 : 1170-1174. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34. Wang, P.-J., S.J. Projan и R.P. Novick. 1991. Нуклеотидная последовательность регуляторных генов бета-лактамаз из стафилококковой плазмиды pI258. Nucleic Acids Res. 19 : 4000 .. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Частота генов антисептической устойчивости в клинических изолятах стафикокков и энтерококков в Турции | Устойчивость к противомикробным препаратам и инфекционный контроль

qacA / B F

qacA / B

GCA GAA AGT GCA GAG TTC G 361 п.н. Noguchi et al.[22]

qacA / B R

qacA / B

CCA GTC CAA TCA TGC CTG

смр ф

смр

GCC ATA AGT ACT GAA GTT ATT GGA 195 п.н. Noguchi et al.[22]

смр рэнд

смр

GAC TAC GGT TGT TAA GAC TAA ACC T

qacG F

qacG

CAA CAG AAA TAA TCG GAA CT 275 п.н. Bjorland et al.[15]

qacG R

qacG

ТАС АТТ ТАА ГАГ САС ТАС А

qacH F

qacH

ATA GTC AGT GAA GTA ATA G 295 п.н. Bjorland et al.[15]

qacH R

qacH

AGT GTG ATG ATC CGA ATG T

qacJ F

qacJ

CTT ATA TTT AGT AAT AGC G 301 п.н. Bjorland et al.[15]

qacJ R

qacJ

GAT CCA AAA ACG TTA AGA

15 Праймеров для кожи, склонной к акне, с одобренными дермы ингредиентами

Праймеры — неизбежное зло в стандартной косметической процедуре.Они необходимы, потому что они фиксируют вашу основу, помогают контролировать масло и обеспечивают гладкую поверхность без складок. Но иногда они могут закупоривать поры, что приводит к высыпаниям, особенно если у вас чувствительная кожа. Вот почему подбор праймера для кожи, склонной к акне, является оптимальным для профилактики. «Праймер — это тонкая увлажняющая сыворотка, которая является первым шагом в повседневном уходе за кожей», — объясняет Эллен Мармур, доктор медицины, президент и основатель Marmur Medical, рекомендуя формулы на водной основе. «Всегда ищите гиалуроновую кислоту и глицерин, чтобы увлажнять и лечить кожу, не забивая поры.«По словам Хайди Вальдорф, доктора медицины Waldorf Dermatology Aesthetics, эти ингредиенты« действуют как губка, впитывая влагу в кожу и удерживая ее, увлажняя кожу и уменьшая образование накипи, не вызывая раздражения ».

Помимо успокаивающего воздействия, ваш праймер также должен работать в тандеме с вашими продуктами по уходу за кожей. «Идеальный продукт должен способствовать отшелушиванию пор, одновременно увлажняя кожу, и не будет слишком раздражающим», — говорит доктор Адебола Деле-Майкл, медицинский директор отделения дерматологии сияющей кожи. и Laser в Нью-Йорке.Все, что содержит AHA, например гликолевая кислота, работает для кожи, потому что не вызывает слишком сильного раздражения, продолжает д-р Деле-Майкл, что идеально, поскольку макияж предназначен для усиления, а не воспаления.

Впереди лучшие праймеры от прыщей с ингредиентами, одобренными дерматологами, которые помогут раскрыть вашу лучшую кожу (и внешний вид).

Лучшие праймеры для кожи, склонной к акне

«Тем, у кого жирная кожа, матирующая праймер с глиной может поглотить излишки масла», — говорит доктор Вальдорф.«Силикат магния и алюминия в этом продукте делает это».

Работая с японскими суперпродуктами, такими как зеленый чай, рис и водоросли, этот праймер от Tatcha сохраняет кожу гладкой и сияющей в течение всего дня с чистыми ингредиентами, которые помогают минимизировать закупорку пор и высыпание на коже.

Не содержит сульфатов и содержит безопасные для кожи ингредиенты, в том числе семена конопли, голубую агаву и алоэ. Эта формула без силикона и масла из МОЛОКА является победителем, не говоря уже о том, что она веганская и не требует жестокого обращения.

«Этот праймер содержит экстракт коры ивы, который, естественно, содержит салициловую кислоту. Кислота обеспечивает мягкое отшелушивание, очищает кожу и уменьшает накопление кожного сала, а также поддерживает естественный процесс обновления клеток организма», — отмечает д-р Деле-Майкл. «Экстракт коры древнего африканского дерева помогает уменьшить размер пор, уменьшить блеск, уменьшить кожный жир и воспалительные акне».

По словам доктора Вальдорфа, сера в Blemish Rescue обладает противовоспалительным и антибактериальным действием, что делает ее одним из лучших праймеров для кожи, склонной к акне.Фитосфингозин — это жирный спирт, который связывает воду, поддерживая барьер кожи против вредных элементов.

Этот охлаждающий воздушный праймер для мусса от Origins разработан для заметного уменьшения пор и содержит такие ингредиенты, как антираздражающее средство ивы полевого цветка.

Созданный с учетом невероятно легкой формулы, праймер FENTY BEAUTY не забивает поры и хорошо подходит для чувствительной и склонной к акне кожи.

Доктор Деле-Майкл рекомендует этот праймер для «гиалуронанов, которые превращаются в гиалуроновую кислоту в коже, чтобы увеличить увлажнение кожи.»

Этот увлажняющий, обогащенный витаминами и веганский праймер от Smashbox насыщен витаминами B, C и E, а также антиоксидантами, которые сохранят вашу кожу свежей и мягкой.

Масло чайного дерева, эфирное масло, минимизирующее прыщи, является главным ингредиентом Pore Refiner.

Если вы хотите получить сияющий эффект вместо матового, Skin Love Glow Elixir все еще борется с прыщами, поскольку это формула на водной основе, наполненная витамином Е, медом, водорослями и экстрактом пиона.

Это личный фаворит: до этого продукта я не был опытным пользователем.Я боролась с ужасными гормональными прыщами, и мне потребовался праймер, потому что моя кожа была сухой, а тональный крем потрескался и стал липким. Этот продукт никогда не раздражал мою кожу и не подчеркивал мои пятна. Текстура легкая, нежирная, ее даже не чувствуешь на коже.

Тонированная грунтовка выбивает две ступени за одну. Легкое покрытие скрывает шрамы от прыщей, пятна и неровности кожи, в то время как SPF в нем «всегда хорошая идея», — отмечает доктор Деле-Майкл.

Авокадо в формуле успокаивает раздражение, а семена сафлора увлажняют.

Veil Mineral не содержит масел (идеально подходит для любого средства от прыщей), имеет минеральную основу и имеет SPF 15, необходимый круглый год.

Эксперты:

Доктор Эллен Мармур , президент и основатель Marmur Medical

Доктор Хайди Вальдорф , основатель Waldorf Dermatology Aesthetics 9000

Адебола Деле-Майкл , медицинский директор отделения дерматологии и лазера Radiant Skin в Нью-Йорке

Эта статья была первоначально опубликована на

Взаимосвязь между содержанием цинка и антисептическим действием цинкосодержащих эпоксидных грунтовок

1. Введение в эпоксидную грунтовку с высоким содержанием цинка

Эпоксидная грунтовка с высоким содержанием цинка является наиболее часто используемой грунтовкой для тяжелых антикоррозионных покрытий. Верхнее покрытие может сочетаться с эпоксидным верхним покрытием, акриловым полиуретановым верхним покрытием, фторуглеродной краской и т. Д.

Люди, знакомые с краской, обнаружат, что цена той же марки эпоксидной грунтовки с высоким содержанием цинка сильно отличается из-за разницы в содержании цинка. .Почему это? Чтобы прояснить этот вопрос, давайте сначала рассмотрим влияние содержания цинка в эпоксидной грунтовке с высоким содержанием цинка.

2. Содержание цинка в эпоксидной грунтовке с высоким содержанием цинка

Антикоррозийный механизм подобранной грунтовки в краске обычно включает защиту, изоляцию и жертвоприношение. Роль цинка в эпоксидной грунтовке с высоким содержанием цинка заключается в защите основания, жертвуя собой. Всем известно, что основа для генерального лакокрасочного покрытия — это сталь, но по химическим свойствам цинк более активен, чем сталь.Когда коррозионная среда в воздухе достигает основы, чтобы вступить с ней в реакцию, цинк в пленке краски сначала вступает в реакцию с коррозионной средой с образованием оксида цинка, инертного продукта, прикрепленного к поверхности стали, тем самым продлевая время защиты от коррозии. краска. Эта реакция называется электрохимической реакцией. В определенной степени, чем выше содержание цинка в эпоксидной грунтовке с высоким содержанием цинка, тем дольше длится эта реакция. Другими словами, чем выше содержание цинка, тем больше время защиты от коррозии.Вот почему, чем выше содержание цинка в эпоксидной грунтовке с высоким содержанием цинка, тем выше ее цена.

В настоящее время содержание цинка в национальной стандартной эпоксидной грунтовке с высоким содержанием цинка обычно составляет около 70%. Таким образом, цена этой грунтовки с высоким содержанием цинка относительно высока, и она в основном используется при строительстве ключевых объектов. Кроме того, содержание цинка относится к содержанию цинка в сухой пленке, которое следует уточнить. Чтобы получить дополнительную информацию о грунтовке с высоким содержанием цинка, обратите внимание на последние новости компании Tianjin Jinhai Special Coatings & Decoration Co., ООО

Акриловая грунтовка глубокого проникновения с антисептиком

доллар США
3050.0 / шт.
3050,0

Гидрофобизирующий состав для придания водоотталкивающих свойств пористым строительным материалам. Для защиты фасадов известковых и цементных штукатурок от атмосферной влаги и капиллярного всасывания. Назначение Кристаллизол Гидрофобизатор: Применяется для обработки пористых строительных материалов: бетона, кирпича, гипса, дерева, гипса. Стенки пор и все частицы материала, контактирующие с водоотталкивающим средством, окутаны невидимой тончайшей водоотталкивающей пленкой.Обрабатываемый материал теряет способность смачиваться водой и капиллярно впитывать ее. При нанесении состава на поверхность на стенках пор образуется тонкий слой полимера, который не смачивается водой и не позволяет воде проникать в поры. Crystallisol Hydrophobizator оставляет поры открытыми, а паропроницаемость строительных материалов остается практически на исходном уровне. Благодаря устройству гидрофобного барьера материал приобретает водоотталкивающие свойства, которые сохраняются длительное время, повышая его устойчивость к загрязнениям и повреждению плесенью.При обработке фасада рекомендуется аккуратно наносить материал на поверхность, избегая контакта со стеклом, пластиковыми оконными рамами и другими частями конструкции, не требующими обработки. Перед нанесением закройте такие места бумагой, строительным скотчем. Описание Crystallisol Hydrophobizator: водный раствор на основе метилсиликонатов, которые, проникая в поры структуры, защищают ее от капиллярного притока воды, изменяя краевой угол смачивания поверхности.Свойства Crystallisol Hydrophobizator: Обладает высокой химической стойкостью и устойчивостью к атмосферным воздействиям. Не образует поверхностного слоя. Не препятствует испарению влаги из материала. Придает материалам водо- и грязеотталкивающие свойства. Сохраняет цвет и текстуру поверхности. Огнестойкий. Работы проводить в сухую погоду при температуре не ниже + 5 ° С. Расход материала: 1 литр концентрата — 155 м² поверхности. Фасовка: канистра полиэтиленовая 1 л.

средств по уходу за ногтями | FDA

Важно использовать продукты для ногтей безопасно, следуя указанным на этикетках инструкциям и обращая внимание на все предупреждения.Следующая информация отвечает на общие вопросы о некоторых продуктах и ​​ингредиентах для ногтей.


Как регулируются продукты для ногтей

Продукты для ногтей для домашнего и салонного использования регулируются Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов. Согласно Федеральному закону о пищевых продуктах, лекарствах и косметических средствах (Закон FD&C), эти продукты обычно считаются косметическими [Закон FD&C, раздел 201 (i)].

Средства для ногтей, предназначенные для лечения медицинских проблем, таких как грибок ногтей, являются лекарственными средствами.Информация на этой странице относится к косметическим средствам для ногтей. Чтобы узнать больше о различиях между косметикой и лекарствами, см. «Это косметическое средство, лекарство или и то, и другое? (Или это мыло?) ».

По закону, товары для ногтей, продаваемые в США, должны быть безопасными для потребителей при использовании в соответствии с указаниями на этикетке или обычным или общепринятым способом (см. Основные юридические концепции: торговля между штатами, подделка и неправильный брендинг). Многие продукты для ногтей содержат потенциально вредные ингредиенты, но разрешены на рынке, потому что они безопасны при использовании по назначению.Например, некоторые ингредиенты для ногтей вредны при проглатывании, но не при нанесении на ногти, потому что ноготь является барьером, препятствующим всасыванию.

Этикетки всей косметики, предназначенной для потребителей или салонов, должны включать предупреждение, когда это необходимо или целесообразно, чтобы предотвратить опасность для здоровья, которая может возникнуть при использовании продукта (21 CFR 740.1).

Косметика, продаваемая потребителям в розничной торговле, например в магазинах или в Интернете, также должна иметь список ингредиентов с названиями ингредиентов, перечисленными в порядке убывания преобладания.Требование декларации ингредиентов не распространяется, например, на продукты, используемые только в салонах, и на бесплатные образцы. Однако продукты должны иметь список ингредиентов, если они также продаются в розницу, даже если они имеют маркировку «Только для профессионального использования» (см. «Маркировка косметики: обзор»).

Согласно закону, косметические продукты и ингредиенты, включая продукты для ногтей, не нуждаются в одобрении FDA перед поступлением на рынок, за исключением большинства цветных добавок. Однако FDA может принимать меры против косметики, не соответствующей закону, или против фирм или лиц, которые нарушают законы, которые мы применяем (см. Полномочия FDA по косметике).

В то время как FDA регулирует продукцию для ногтей, предназначенную для использования дома и в салонах, государственные и местные власти регулируют работу маникюрных салонов и лицензирование мастеров маникюра и мастеров маникюра. Кроме того, Управление по охране труда (OSHA) обратилось к вопросам безопасности сотрудников маникюрных салонов. Чтобы узнать больше, см. «Опасности для здоровья в маникюрных салонах» на веб-сайте OSHA.

Безопасное использование продуктов для ногтей

Потребители должны внимательно читать этикетки на продуктах для ногтей и соблюдать все предупреждения.Как отмечалось выше, некоторые ингредиенты в продуктах для ногтей могут причинить вред при проглатывании. Некоторые из них могут легко загореться, если подвергнуться воздействию пламени проблескового маячка плиты, зажженной сигареты или другого источника тепла, такого как нагревательный элемент щипцов для завивки. Продукты для ногтей также могут быть опасны при попадании в глаза. Некоторые продукты для ногтей могут вызывать инфекции и аллергические реакции. При использовании средств для ногтей убедитесь, что у вас хорошая вентиляция. Если у вас есть реакция на продукт для ногтей, сообщите об этом в FDA.

Некоторые общие ингредиенты продуктов для ногтей

Вот информация о некоторых ингредиентах продуктов для ногтей, о которых часто спрашивают или которые вызывают особые опасения по поводу безопасности:

Ацетонитрил в средствах для снятия искусственных ногтей

Жидкости для снятия искусственных ногтей состоят в основном из ацетонитрила. Для всех жидких бытовых средств для удаления клея, содержащих более 500 миллиграммов ацетонитрила в одной емкости [16 CFR 1700.14 (18)]. Комиссия по безопасности потребительских товаров (CPSC) обеспечивает соблюдение этого требования в соответствии с Законом об упаковке для предотвращения отравления [15 U.S.C. 1471-1476]. Однако тот факт, что продукт находится в упаковке, защищенной от доступа детей, не означает, что ребенок не может ее открыть.

Как и любой косметический продукт, который может быть опасен при неправильном использовании, для этих средств для удаления искусственных ногтей важно иметь соответствующее предупреждение на этикетке вместе с инструкциями по безопасному использованию.

наверх

Формальдегид в отвердителях и лаках для ногтей

Формальдегид входит в состав некоторых отвердителей и лаков для ногтей.Он может быть указан на этикетке продукта как формальдегид или под другими названиями, такими как «формалин» и метиленгликоль ». В отвердителях для ногтей формальдегид связывается с кератином, который естественным образом встречается в ногтях, делая ногти более твердыми. Однако частое использование этих отвердителей для ногтей может сделать ногти ломкими и, скорее всего, сломаться или отслоиться. Продукты для ногтей, содержащие формальдегид, также могут вызывать раздражение кожи, а также аллергические реакции на этот ингредиент.

Другие продукты для ногтей содержат смолы, которые образуют прочное покрытие на ногтях, а не укрепляют сами ногти.Например, толуолсульфонамид / формальдегидная смола (TSFR) используется в некоторых лаках для ногтей, чтобы сделать покрытие прочным и эластичным. TSFR также способствует прилипанию лака к ногтю, придает блеск и помогает продукту хорошо растекаться при нанесении. Есть данные, что у некоторых людей может развиться аллергия на TSFR.

Если у вас аллергия на формальдегид, вы ранее испытывали аллергическую реакцию на препараты для ногтей, содержащие формальдегид, или по какой-либо другой причине вы не хотите использовать этот ингредиент, обязательно прочтите описание ингредиента на этикетке, чтобы узнать, содержит ли продукт формальдегид или родственные ему вещества. ингредиенты, такие как формалин, метиленгликоль или толунесульфонамид / формальдегидная смола.

Метакрилатные мономеры в искусственных ногтях («Акрил»)

Искусственные ногти состоят в основном из акриловых полимеров и изготавливаются путем взаимодействия акриловых мономеров, таких как мономер этилметакрилата, с акриловыми полимерами, такими как полиметилметакрилат. Когда реакция завершится, в полимере, вероятно, останутся следы мономера. Например, следы мономеров метакрилата остаются после формирования искусственных ногтей. Сами полимеры, как правило, вполне безопасны, но следы реактивных мономеров могут привести к побочным реакциям, таким как покраснение, отек и боль в ногтевом ложе, у людей, которые стали чувствительными (аллергическими) к метакрилатам.

В начале 1970-х годов FDA получило ряд жалоб на травмы, связанные с использованием искусственных ногтей, содержащих мономер метилметакрилата. Среди этих травм были сообщения о повреждении и деформации ногтей, а также о контактном дерматите. В отличие от мономера метилметакрилата, полимеры этилметакрилата не были связаны с этими повреждениями. Основываясь на расследовании травм и обсуждениях с медицинскими экспертами в области дерматологии, FDA решило в то время удалить с рынка продукты, содержащие 100-процентный мономер метилметакрилата, в судебном порядке, в результате чего был вынесен предварительный судебный запрет против одной фирмы, а также несколько изъятий и добровольных отзывов.

Нет нормативных положений, конкретно запрещающих использование мономера метилметакрилата в косметических продуктах.

Экспертная группа по обзору косметических ингредиентов (CIR) в 2002 году определила, что этилметакрилат безопасен при использовании, когда приложение сопровождается инструкциями по предотвращению контакта с кожей из-за его сенсибилизирующего потенциала, то есть возможности того, что у человека может появиться аллергия на него.

Мономер метилметакрилата все еще иногда используется в некоторых изделиях для искусственных ногтей, а мономер этилметакрилата иногда используется в акриловых ногтях.Оба они иногда встречаются в других продуктах для ногтей, например, в лаках для ногтей. Важно избегать контакта с кожей, чтобы свести к минимуму вероятность аллергической реакции.

Метакриловая кислота в праймерах для ногтей

Несмотря на похожие названия, метакриловая кислота отличается от мономеров метакрилата. Он также используется по-разному и вызывает различные проблемы с безопасностью. Метакриловая кислота (MAA) используется в праймерах для ногтей, чтобы помочь акриловым ногтям прилипать к поверхности ногтей.Праймеры для ногтей, содержащие MAA, чаще всего распространяются через оптовых поставщиков в маникюрные салоны и розничные магазины косметики, и обычно они имеют маркировку «Только для профессионального использования». Однако некоторые из этих розничных магазинов продают товары как профессионалам, так и потребителям.

Из-за случаев отравления и травм, связанных с этими продуктами, CPSC требует защищенной от детей упаковки для некоторых бытовых товаров, включая грунтовки для ногтей, содержащие MAA. Подробные сведения об этих требованиях см. В постановлении 16 CFR 1700.14 (29).

Фталаты в лаках для ногтей и других продуктах для ногтей

Фталаты — это группа химикатов, используемых в самых разных продуктах, от игрушек до ковровых покрытий и медицинских трубок. В лаках для ногтей они используются в основном в концентрациях менее 10% в качестве пластификаторов, чтобы уменьшить растрескивание и сделать ногти менее хрупкими.

Дибутилфталат (DBP) чаще всего используется в лаках для ногтей и некоторых других продуктах, таких как отвердители для ногтей, в то время как диметилфталат (DMP) и диэтилфталат (DEP) используются изредка.Однако в последнем исследовании фталатов в косметике, проведенном FDA в 2010 году, DBP был обнаружен только в нескольких лаках для ногтей, в то время как DEP и DMP не были обнаружены ни в одном из исследуемых продуктов для ногтей. Для получения информации по вопросам здоровья, связанных с фталатами в косметике, и таблицы результатов опроса, пожалуйста, см. Фталаты.

Толуол в лаках для ногтей и других продуктах для ногтей

Толуол используется в качестве растворителя в различных продуктах для ногтей, включая некоторые лаки для ногтей, отвердители для ногтей и жидкости для снятия лака; однако его использование постепенно прекращается.CIR рассмотрел толуол в 1987 году, определив, что он безопасен для использования в продуктах для ногтей при концентрациях до 50 процентов, что является самой высокой концентрацией, наблюдаемой в продуктах для ногтей.

CIR снова пересмотрел свою оценку безопасности толуола в 2005 году вместе с новой информацией. В то время CIR подтвердил, что во многих новых исследованиях представлены результаты, согласующиеся с данными его более ранней оценки безопасности, в том смысле, что любые зарегистрированные побочные эффекты имели место только на уровнях, во много раз превышающих те, которые наблюдались при использовании лака для ногтей, и что это число количество продуктов для ногтей, содержащих толуол, резко упало.

Сообщение о нежелательной реакции на ногтевой продукт

Если вы потребитель или специалист по маникюру, у которого была плохая реакция на продукт для ногтей, сообщите об этом своему врачу или другому поставщику медицинских услуг, а затем сообщите об этом в FDA. Закон не требует, чтобы косметические компании сообщали о жалобах в FDA, поэтому ваша информация — очень важный способ для FDA узнать о проблемной косметике на рынке. Вы можете сообщить о проблемах со здоровьем, связанных с косметикой, в том числе с продуктами для ногтей, следующими способами:

Чтобы узнать больше о том, как сообщить о проблемах, связанных с косметикой, см. «Подача жалобы: как сообщить о проблеме, связанной с косметикой».”

* Экспертная группа по проверке косметических ингредиентов (CIR) — это независимая, финансируемая промышленностью группа экспертов в области медицины и токсикологии, которая проводит ежеквартальные встречи для проведения оценки безопасности косметических ингредиентов и публикует свои выводы в журналах с независимой экспертной оценкой.