Отдел продаж

Телефоны: (3532) 25-27-22, 93-60-02, 93-50-02

E-mail: [email protected]

г.Оренбург, ул.Беляевская, д.50/1, стр.1

 

Разное

Структурит праймер: STRUCTURITE PRIMER (Структурит Праймер) — Бентоматы Гидрогарант

Содержание

№ 42301 Тендер на футерованные детали труб-да для АО Апатит от 16 апреля 2019 | Москва

Наименование позиции ОКПД Документ Количество
Труба 426х8 ГОСТ 10704-91 09Г2С L=5500мм с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 376 шт
Труба 426х8 ГОСТ 10704-91 09Г2С L=4000мм с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 33 шт
Отвод 22град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 16 шт
Отвод 7град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 15 шт
Отвод 19град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 12 шт
Отвод 13град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 8 шт
Отвод 90 426х8 черт.СЭКП.10.463.000 СБ с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 8 шт
Тройник сварной 400-16 черт.СЭКП.10.427.000 СБ с футеровкой Эластэкс-А243Т s=15мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 8 шт
Отвод 16град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 7 шт
Отвод 10град. 426х8 Ру1,6МПа a=200мм b=200, с наружной антикоррозионной изоляцией, футеровкой Эластэкс-А243Т s=10мм в комплекте с двумя поворотными фланцами 400-1,6-02-1 09Г2С ГОСТ 33259-2015, метизами 7 шт

Государственные сметные нормативы Федеральные сметные цены на материалы, изделия, конструкции и оборудование, применяемые в строительстве ФССЦ 81-01-2001 Книги 01-04 (утв. приказом Министерства строительства и жилищно-коммунального хозяйства РФ от 30 дека стр. 12

Группа 04.3.02.09: Смеси на цементной основе (ГОСТ 31189-2015, ГОСТ 31357-2007)

04.3.02.09-0001

Сухая смесь на основе высокоактивного портландцемента и кварцевых заполнителей MasterTop 135 PG для устройства высокопрочного покрытия бетонных полов, цвет светло- серый

кг

5,92

6,07

04.3.02.09-0002

Сухая смесь на основе высокоактивного портландцемента и кварцевых заполнителей MasterTop 135 PG для устройства высокопрочного покрытия бетонных полов, цвет слоновая кость

кг

5,09

5,22

04. 3.02.09-0003

Сухая смесь на основе высокоактивного портландцемента и кварцевых заполнителей MasterTop 135PG для устройства высокопрочного покрытия бетонных полов, цвет терракотовый

кг

4,88

5,01

04.3.02.09-0004

Сухая смесь на основе высокоактивного портландцемента и металлических заполнителей MASTERTOP 200 для упрочнения поверхности бетонных полов, цвет натуральный

кг

16,91

17,28

04.3.02.09-0101

Затирка «Боларс» (разной цветности)

т

6 975,93

7 159,36

04.3.02.09-0102

Затирка «Старатели» (разной цветности)

т

6 342,24

6 513,00

04.3.02.09-0201

Обмазка паропроницаемая для декоративной отделки реставрируемой поверхности фасада «БИРСС 31 ОД»

т

19 069,07

19 485,65

04. 3.02.09-0301

Покрытие двухкомпонентное полимерцементное для гидроизоляции минеральных поверхностей «БИРСС Гермоластик»

т

25 689,19

26 238,17

04.3.02.09-0302

Покрытие эластичное двухкомпонентное полимерцементное для бетонных поверхностей «БИРСС Файншлам ELK»

т

29 260,09

29 880,49

04.3.02.09-0401

Раствор быстротвердеющий на основе цемента PCI POLYFIX PLUS

кг

11,77

12,04

Смеси сухие для гидроизоляции и ремонта строительных конструкций, модификации бетона, Лахта:

04.3.02.09-0411

быстрый ремонт

кг

18,79

19,20

04.3.02.09-0412

водяная пробка

кг

41,49

42,35

04.3.02.09-0413

комплексная добавка в бетон

кг

21,38

21,84

04. 3.02.09-0414

обмазочная гидроизоляция

кг

23,33

23,83

04.3.02.09-0415

проникающая гидроизоляция

кг

42,14

43,01

04.3.02.09-0416

ремонтный состав базовый

кг

14,89

15,22

04.3.02.09-0417

шовная гидроизоляция

кг

29,49

30,11

04.3.02.09-0418

штукатурная гидроизоляция

кг

15,87

16,22

04.3.02.09-0501

Смеси сухие известково-цементные кладочные М100

т

524,62

570,31

04.3.02.09-0601

Смесь-герметик для ликвидации «живых» течей, марка «GLIMS ГидроПломба»

кг

78,45

80,05

04.3. 02.09-0701

Смесь сухая для упрочнения бетонных промышленных полов, марка «Sikafloor 2 Syntop»

кг

25,57

26,11

04.3.02.09-0702

Смесь сухая для упрочнения бетонных промышленных полов, марка «Sikafloor 3 Quartztop»

кг

17,60

17,98

04.3.02.09-0703

Смесь быстротвердеющая на цементной основе «ПЛИТОНИТ-Аквабарьер Гидростоп»

т

7 379,90

7 562,70

04.3.02.09-0704

Смесь двухкомпонентная для защиты от коррозии металла «БИРСС Гермоластик-Антикор»

т

23 969,87

24 484,47

04.3.02.09-0705

Смесь двухкомпонентная для создания пароизоляционного покрытия поверхностей «БИРСС Гермоластик Я»

т

17 357,09

17 739,43

04.3.02.09-0706

Смесь для быстрой заделки протечек «БИРСС Гидромиг»

т

30 615,71

31 263,22

04. 3.02.09-0707

Смесь для срочного ремонта бетонных поверхностей «БИРСС РСМ-350 защитный слой»

т

3 127,15

3 224,89

04.3.02.09-0708

Смесь монтажно-кладочная с противоморозной добавкой «БИРСС 1М» (марка М200)

т

857,28

909,63

04.3.02.09-0709

Смесь монтажно-кладочная с противоморозной добавкой «БИРСС 3М» (марка М100)

т

622,34

669,99

04.3.02.09-0710

Смесь монтажно-кладочная цементно-известково-песчаная с противоморозной добавкой «БИРСС 41М Антивысол» (марки М75)

т

1 075,55

1 132,26

04.3.02.09-0711

Смесь ремонтная «БИРСС 58 С-1» (марка М150)

т

2 106,61

2 183,94

04.3.02.09-0712

Смесь ремонтная «БИРСС Бетоншпахтель»

т

3 335,13

3 437,03

04. 3.02.09-0713

Смесь ремонтная «БИРСС РБГ» (марка М500)

т

2 852,53

2 944,78

04.3.02.09-0714

Смесь ремонтная «БИРСС РСМ-450-1»

т

2 870,56

2 963,17

04.3.02.09-0715

Смесь ремонтная «БИРСС РСМ-450-1М»

т

3 576,29

3 683,02

04.3.02.09-0716

Смесь ремонтная «БИРСС Шпритцбетон» (марка М400) методом сухого торкретирования

т

2 511,76

2 597,20

04.3.02.09-0717

Смесь ремонтная бетонная «БИРСС 59 С-3»

т

2 698,95

2 788,13

04.3.02.09-0718

Смесь ремонтная бетонная «БИРСС 59Ц» (марка М400)

т

2 798,65

2 889,82

04.3.02.09-0719

Смесь ремонтная по бетонным основаниям «БИРСС 28Ш» (марка М300)

т

1 686,00

1 754,92

04. 3.02.09-0720

Смесь ремонтная тиксотропная «БИРСС 59 С-2» (марка М600)

т

2 595,25

2 682,36

04.3.02.09-0721

Смесь ремонтная тиксотропная «БИРСС РСМ-400-2М», для механизированного нанесения

т

2 090,17

2 167,17

04.3.02.09-0722

Смесь ремонтная тиксотропная «БИРСС РСМ-400-2ММ»

т

2 173,78

2 252,46

04.3.02.09-0723

Смесь ремонтная штукатурная «БИРСС 28» для работ по влажным поверхностям

т

1 283,30

1 344,17

04.3.02.09-0724

Смесь ремонтная штукатурная «БИРСС 29» для засоленных и пораженных грибком поверхностей

т

924,55

978,24

04.3.02.09-0725

Смесь ремонтная штукатурная «БИРСС РСМ-350-2»

т

2 515,98

2 601,50

04. 3.02.09-0726

Смесь ремонтная штукатурная «БИРСС РСМ-350-2М», для ручного нанесения

т

2 006,56

2 081,89

04.3.02.09-0727

Смесь ремонтная штукатурная «БИРСС РСМ-350-2ММ», для механизированного нанесения

т

2 056,73

2 133,06

04.3.02.09-0728

Смесь ремонтная штукатурная двухкомпонентная «БИРСС РСМ- 350-1»

т

2 757,53

2 847,88

04.3.02.09-0729

Смесь ремонтная штукатурная по бетонным основаниям «БИРСС 30»

т

1 326,48

1 388,21

04.3.02.09-0730

Смесь силикатно-штукатурная

т

227,54

267,29

Смесь сухая:

04.3.02.09-0741

(фуга) АТЛАС разных цветов для заделки швов водостойкая

т

8 789,02

9 000,00

04. 3.02.09-0742

«Кальмафлекс» для повышения водонепроницаемости, морозостойкости и защиты от коррозии поверхностей бетонных и железобетонных конструкций, уплотнения, герметизации и тампонирования стыков, швов, мест протечек, плотность смеси — 1850

кг

33,21

33,90

04.3.02.09-0743

арктика

т

8 817,18

9 028,72

04.3.02.09-0744

АТЛАС бежевая

т

13 884,50

14 197,39

04.3.02.09-0745

АТЛАС бледно-пастельная

т

13 884,50

14 197,39

04.3.02.09-0746

АТЛАС вересковая

т

13 884,50

14 197,39

04.3.02.09-0747

АТЛАС голубая

т

16 376,22

16 738,94

04.3.02.09-0748

АТЛАС графитовая

т

11 954,89

12 229,19

04. 3.02.09-0749

АТЛАС зеленая

т

13 884,50

14 197,39

04.3.02.09-0750

АТЛАС кирпичная

т

13 884,50

14 197,39

04.3.02.09-0751

АТЛАС коричнево-желтая

т

13 884,50

14 197,39

04.3.02.09-0752

АТЛАС мальва

т

11 954,89

12 229,19

04.3.02.09-0753

белая

т

8 682,94

8 891,80

04.3.02.09-0754

водоостанавливающая быстрого твердения марка «Ватерплаг»

кг

43,55

44,45

04.3.02.09-0755

водоостанавливающая мгновенного твердения марка «Пенеплаг»

кг

90,71

92,55

04.3.02.09-0801

Смесь сухая гидроизоляционная обмазочная эластичная «АкваНАСТ-А»

т

36 457,32

37 221,67

04. 3.02.09-0802

Смесь сухая: гидроизоляционная проникающая «Кальматрон» (ТУ 5745-001-47517383-00)

кг

15,03

15,36

Смесь сухая гидроизоляционная проникающая:

04.3.02.09-0811

Гидротэкс-Б

кг

39,83

40,66

04.3.02.09-0812

Гидротэкс-В

кг

17,75

18,14

04.3.02.09-0813

Гидротэкс-К

кг

41,80

42,67

04.3.02.09-0814

Гидротэкс-Л

кг

95,49

97,43

04.3.02.09-0815

Гидротэкс-Р

кг

8,21

8,40

04.3.02.09-0816

Гидротэкс-У

кг

17,43

17,81

04.3.02.09-0817

Гидротэкс-Ш

кг

27,63

28,21

Смесь сухая:

04. 3.02.09-0821

гидроизоляционная проникающая капиллярная марка «Пенетрон»

кг

77,37

78,95

04.3.02.09-0822

для гидроизоляции швов, стыков, трещин марка «Пенекрит»

кг

69,87

71,30

04.3.02.09-0823

для заделки швов (фуга) АТЛАС «КНАУФ-МП75»

т

1 765,74

1 836,60

04.3.02.09-0824

для заделки швов (фуга) АТЛАС растворная для ручной работы

т

2 416,13

2 500,00

04.3.02.09-0825

модифицированная с полимерными добавками для ремонтных работ, марка «Структурит 300»

кг

45,77

46,72

04.3.02.09-0826

модифицированная с полимерными добавками для ремонтных работ, марка «Структурит НВ»

кг

28,95

29,56

04. 3.02.09-0827

Смесь сухая на основе высокоактивного портландцемента и кварцевых заполнителей MASTERTOP 100 для упрочнения поверхности бетонных полов, цвет зеленый

кг

7,36

7,54

04.3.02.09-0828

Смесь сухая на основе высокоактивного портландцемента и кварцевых заполнителей MASTERTOP 100 для упрочнения поверхности бетонных полов, цвет натуральный

кг

3,57

3,67

04.3.02.09-0829

Смесь сухая на основе высокоактивного портландцемента и кварцевых заполнителей MASTERTOP 100 для упрочнения поверхности бетонных полов, цвет светло-серый

кг

4,88

5,01

04.3.02.09-0830

Смесь сухая на основе высокоактивного портландцемента и кварцевых заполнителей MASTERTOP 100 для упрочнения поверхности бетонных полов, цвет терракотовый

кг

4,92

5,05

04. 3.02.09-0831

Смесь сухая на основе высокоактивного портландцемента и кварцевых заполнителей MasterTop 135 PG для устройства высокопрочного покрытия бетонных полов, цвет натуральный

кг

7,74

7,93

04.3.02.09-0832

Смесь сухая на основе высокоактивного портландцемента и корундовых заполнителей MASTERTOP 450 для упрочнения поверхности бетонных полов, цвет зеленый

кг

9,84

10,07

04.3.02.09-0833

Смесь сухая на основе высокоактивного портландцемента и корундовых заполнителей MASTERTOP 450 для упрочнения поверхности бетонных полов, цвет натуральный

кг

5,03

5,16

04.3.02.09-0834

Смесь сухая на основе высокоактивного портландцемента и корундовых заполнителей MASTERTOP 450 для упрочнения поверхности бетонных полов, цвет светло-серый

кг

7,24

7,42

04. 3.02.09-0835

Смесь сухая на основе высокоактивного портландцемента и корундовых заполнителей MASTERTOP 450 для упрочнения поверхности бетонных полов, цвет терракотовый

кг

7,24

7,42

04.3.02.09-0836

Смесь сухая на основе высокоактивного портландцемента и корундовых заполнителей MasterTop 450 PG для устройства высокопрочного покрытия бетонных полов, цвет натуральный

кг

9,71

9,93

04.3.02.09-0837

Смесь сухая на основе высокоактивного портландцемента и металлических заполнителей MASTERTOP 230 для устройства тонкослойного высокопрочного покрытия бетонных полов, цвет натуральный

кг

16,91

17,28

04.3.02.09-0838

Смесь сухая на основе гидравлических вяжущих и металлических заполнителей MASTERTOP 210 для устройства тонкослойного высокопрочного покрытия бетонных полов, цвет натуральный

кг

16,91

17,28

Смесь сухая:

04. 3.02.09-0839

на цементной основе, модифицированная полимерами PCI REPAHAFT

кг

21,78

22,25

04.3.02.09-0840

ремонтная инъекционная марка «Скрепа М 600»

кг

15,07

15,40

04.3.02.09-0841

ремонтная марка «Скрепа М 500»

кг

11,72

11,99

04.3.02.09-0842

Смесь сухая ремонтная наливная высокопрочная MasterEmaco S 5450 PG (EMACO NANOCRETE R4 Fluid)

кг

23,96

24,47

04.3.02.09-0843

Смесь сухая ремонтная с пониженным модулем упругости для чистовой отделки MasterEmaco N 5100 (EMACO NANOCRETE FC) тиксотропного типа

кг

26,86

27,43

04.3.02.09-0844

Смесь сухая ремонтная тиксотропная высокопрочная MasterEmaco S 5400 (EMACO NANOCRETE R4)

кг

18,13

18,52

04. 3.02.09-0845

Смесь сухая ремонтная тиксотропная с пониженной плотностью MasterEmaco S 5300 (EMACO NANOCRETE R3)

кг

23,84

24,35

04.3.02.09-0846

Смесь сухая ремонтная тиксотропная с пониженным модулем упругости MasterEmaco N 5200 (EMACO NANOCRETE R2)

кг

27,00

27,57

Смесь сухая строительная гидроизоляционная «Доктор Бетон» тип:

04.3.02.09-0851

B122

кг

49,24

50,26

04.3.02.09-0852

C112

кг

19,43

19,85

04.3.02.09-0853

C113

кг

56,55

57,71

04.3.02.09-0854

C212

кг

13,30

13,60

04.3.02.09-0855

D222

кг

15,13

15,46

04. 3.02.09-0856

E131

кг

18,47

18,87

04.3.02.09-0857

F122

кг

59,45

60,67

04.3.02.09-0858

А111

кг

70,14

71,57

Смесь сухая строительная гидроизоляционная, марка «ПРОНИКС»:

04.3.02.09-0861

гидропломба

кг

49,17

50,19

04.3.02.09-0862

комплексная модифицирующая добавка в бетон

кг

23,13

23,62

04.3.02.09-0863

литьевой

кг

15,02

15,35

04.3.02.09-0864

наноцемент

кг

4,68

4,80

04.3.02.09-0865

обмазочный

кг

17,91

18,30

04. 3.02.09-0866

проникающий

кг

49,18

50,19

04.3.02.09-0867

ремонтный

кг

15,02

15,35

04.3.02.09-0868

сверхпроникающий

кг

65,09

66,42

04.3.02.09-0869

стяжка-ровнитель высокопрочный гидроизоляционный с микрофиброй

кг

4,61

4,73

04.3.02.09-0870

торкрет

кг

7,06

7,23

04.3.02.09-0871

Теплостоп

3 166,84

3 247,61

04.3.02.09-0872

шовный

кг

49,18

50,19

04.3.02.09-0873

штукатурный

кг

16,76

17,13

04.3.02. 09-0874

эластичный

кг

52,07

53,14

Смесь сухая строительная для защиты, гидроизоляции и ремонта бетона, марка:

04.3.02.09-0881

«КТ трон-1» (проникающий)

кг

64,96

66,29

04.3.02.09-0882

«КТ трон-2 эласт» (шовный)

кг

25,69

26,23

04.3.02.09-0883

«КТ трон-2» (шовный)

кг

58,47

59,67

04.3.02.09-0884

«КТ трон-3 Л600» (литьевой ремонтный состав)

кг

16,83

17,20

04.3.02.09-0885

«КТ трон-3 Т500» (тиксотропный ремонтный состав)

кг

14,47

14,79

04.3.02.09-0886

«КТ трон-3» (ремонтный состав)

кг

13,29

13,59

04. 3.02.09-0887

«КТ трон-4 Т600»

кг

21,04

21,49

04.3.02.09-0888

«КТ трон-4» (быстрый ремонт)

кг

15,95

16,30

04.3.02.09-0889

«КТ трон-5» (добавка в бетон)

кг

19,19

19,60

04.3.02.09-0890

«КТ трон-6» (штукатурный)

кг

11,81

12,08

04.3.02.09-0891

«КТ трон-7» (обмазочный)

кг

14,76

15,09

04.3.02.09-0892

«КТ трон-8» (водяная пробка)

кг

40,16

40,99

04.3.02.09-0893

«КТ трон-10 2К»

кг

35,43

36,17

04.3.02.09-0894

«КТ трон-51» (гидроизоляционная добавка в бетон)

кг

51,67

52,73

04. 3.02.09-0895

«КТ трон-торкрет С»

кг

6,94

7,11

04.3.02.09-0901

Смесь сухая строительная инъекционная, марка «Микролит»

кг

15,75

16,10

Смесь сухая строительная серия ТФ-2, марка:

04.3.02.09-0911

НБМ

кг

7,75

7,94

04.3.02.09-0912

НБС

кг

7,06

7,23

04.3.02.09-0913

РС1

кг

9,68

9,90

04.3.02.09-0914

РС-3

кг

9,93

10,16

04.3.02.09-0915

РС-4

кг

13,48

13,78

04.3.02.09-0916

ТФ-2

кг

17,11

17,48

04. 3.02.09-0921

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650)

т

3 952,99

4 067,25

04.3.02.09-0922

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650)1, цвет жёлтый

т

9 421,76

9 645,40

04.3.02.09-0923

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650), цвет голубой

т

7 933,89

8 127,77

04.3.02.09-0924

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650), цвет зеленый

т

7 537,12

7 723,06

04.3.02.09-0925

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650), цвет зелёный специальный

т

10 876,57

11 129,30

04. 3.02.09-0926

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марка М600-650), цвет красный

т

5 156,52

5 294,85

04.3.02.09-0927

Смесь сухая упрочняющая с кварцевым наполнителем для промышленных полов «БИРСС УК-1» (марки М600-650), цвет серый

т

5 156,52

5 294,85

04.3.02.09-0928

Смесь сухая упрочняющая с корундовым наполнителем для промышленных полов «БИРСС УК-2» (марка М650-700)

т

9 719,33

9 948,92

04.3.02.09-0929

Смесь сухая упрочняющая с корундовым наполнителем для промышленных полов «БИРСС УК-2» (марка М650-700), цвет зеленый

т

14 778,11

15 108,87

04.3.02.09-0930

Смесь сухая упрочняющая с корундовым наполнителем для промышленных полов «БИРСС УК-2» (марка М650-700), цвет красный

т

11 174,14

11 432,82

04. 3.02.09-0931

Смесь сухая упрочняющая с корундовым наполнителем для промышленных полов «БИРСС УК-2» (марка М650-700), цвет серый

т

11 174,14

11 432,82

Смесь сухая:

04.3.02.09-0932

цементная «Ватерплаг» (тампонажная), для заделки активных протечек

кг

47,06

48,03

04.3.02.09-0933

цементная «Торосил», для гидроизоляции по бетону и камню

кг

27,50

28,08

04.3.02.09-0934

цементная гидроизоляционная сульфатоустойчивая Remmers «Sulfatexschlamme»

кг

61,00

62,26

04.3.02.09-0935

цементная для гидроизоляции и герметизации помещений с высокими требованиями к эксплуатации, марка «Глимс-Водоstop»

кг

12,13

12,40

04. 3.02.09-0936

цементная ремонтная, безусадочная, быстросхватывающаяся, «Ренимент RSM 10, 30» (марка М550)

т

1 317,65

1 379,20

04.3.02.09-0937

цементная с полимерными добавками марка «Торотект CR», для устройства гидроизоляции по бетону и камню

кг

43,03

43,92

04.3.02.09-0938

цементная с полимерными добавками, марка «Структурит Праймер», для антикоррозийной защиты арматуры железобетонных конструкций

кг

59,15

60,36

04.3.02.09-1001

Смесь сухая цементная сверхбыстротвердеющая для устранения протечек PCI POLYFIX 5 MIN

кг

35,98

36,73

04.3.02.09-1002

Смесь сухая цементная сверхбыстротвердеющая для устранения протечек PCI POLYFIX 30 SEC

кг

41,79

42,66

04. 3.02.09-1003

Смесь сухая штукатурная цементно-известковая «KREISEL 501» (марка М200)

т

1 506,15

1 571,47

04.3.02.09-1004

Смесь цементная сверхбыстротвердеющая для устранения активных протечек MASTERSEAL 590

кг

19,59

20,01

04.3.02.09-1005

Смесь шпаклевочная на цементной основе, цвет белый АКВАПАНЕЛЬ

кг

14,78

15,11

04.3.02.09-1006

Смесь шпаклевочная на цементной основе, цвет серый АКВАПАНЕЛЬ

кг

13,82

14,13

04.3.02.09-1007

Смесь шпатлевочная, марка «Глимс Magnum»

т

6 582,80

6 750,00

04.3.02.09-1008

Смесь шпатлевочная, марка «Глимс Styro прайм»

т

7 063,19

7 240,00

04. 3.02.09-1009

Смесь штукатурная декоративная «БИРСС 31», для ручного нанесения

т

3 974,28

4 088,97

04.3.02.09-1010

Смесь штукатурная декоративная «БИРСС 32», для механизированного нанесения

т

8 711,82

8 921,26

04.3.02.09-1011

Смесь штукатурная декоративная «БИРСС 50», цвет белый

т

4 624,59

4 752,28

04.3.02.09-1012

Смесь штукатурная декоративная «БИРСС 50», цвет белый (наполненная)

т

6 201,37

6 360,60

04.3.02.09-1013

Смесь штукатурная декоративная «БИРСС 50», цвет белый (червячная)

т

5 114,54

5 252,03

04.3.02.09-1014

Смесь штукатурная сухая «Термопал-СР44»

кг

17,66

18,04

04. 3.02.09-1015

Смесь штукатурно-клеевая на цементной основе «Севенер», КНАУФ

кг

2,56

2,64

04.3.02.09-1101

Состав анкерный цементный гибкий безусадочный «БИРСС 59 С-1» (марка М600)

т

3 558,60

3 664,97

04.3.02.09-1102

Состав анкерный цементный гибкий безусадочный «БИРСС 59 С-1» (марка М800)

т

3 664,63

3 773,12

04.3.02.09-1103

Состав анкерный цементный гибкий безусадочный «БИРСС 59»

т

2 834,00

2 925,88

04.3.02.09-1104

Состав высокоточный подливочный на цементной основе, марка «SikaGrout-316»

кг

38,05

38,84

04.3.02.09-1105

Состав для востановления и устройства горизонтальной изоляции («замка») в кирпичной и каменной кладке химическим путем «БИРСС Гидростоп»

т

17 710,88

18 100,30

04. 3.02.09-1106

Состав для накрывочного декоративного гидрофобного слоя в системе санации «БИРСС С-3»

т

4 115,57

4 233,08

04.3.02.09-1107

Состав для устройства солезащитного промежуточного штукатурного слоя, а также для выравнивания и сглаживания неровных поверхностей «БИРСС С-2»

т

4 346,14

4 468,26

04.3.02.09-1108

Состав на белом цементе для гидроизоляции резервуаров с питьевой водой изнутри «БИРСС Дихтунгшлам TW»

т

10 746,96

10 997,10

04.3.02.09-1109

Состав ремонтный толстослойный с низкой усадкой, армированный фиброй, марка «Sika MonoTop-412N»

кг

26,02

26,57

04.3.02.09-1110

Состав цветной для затирки швов «БИРСС 33»

т

8 515,22

8 729,44

04. 3.02.09-1111

Состав цветной для затирки швов «БИРСС Мраморит-Фуга 33»

т

7 302,23

7 492,19

04.3.02.09-1201

Средство для дополнительной гидроизоляции минеральных поверхностей против воды под давлением «БИРСС Дихтунгшлам»

т

9 819,85

10 051,45

04.3.02.09-1301

Сухая смесь цементная монтажно-кладочная М-200

т

423,74

470,56

04.3.02.09-1401

Шпатлевка минеральная для внутренних работ, марка «Caparol CapaPlan P»

кг

7,87

8,06

04.3.02.09-1402

Шпатлевка минеральная для фасадных работ, марка «Capalith Fassadenspachtel P»

кг

9,62

9,84

04.3.02.09-1501

Штукатурка безусадочная глиняная Ветонит GB

т

7 079,38

7 262,79

04. 3.02.09-1502

Штукатурка влагостойкая и морозостойкая марки WEBER STUK CEMENT

т

7 192,40

7 371,45

04.3.02.09-1511

Штукатурка декоративная минеральная «БИРСС Термопор 50» (марка М75)

т

4 375,15

4 497,85

04.3.02.09-1512

Штукатурка минеральная декоративная «шуба», марка «GLIMS Decor»

кг

4,22

4,34

04.3.02.09-1513

Штукатурка минеральная декоративная CERESIT CT 35 «короед», зерно 2,5 мм (цветная)

кг

5,54

5,68

04.3.02.09-1514

Штукатурка минеральная декоративная CERESIT CT 35 «короед», зерно 3,5 мм (цветная)

кг

5,86

6,01

04.3.02.09-1515

Штукатурка минеральная декоративная CERESIT CT 35, зерно 2,5 мм (белая)

кг

4,95

5,08

04. 3.02.09-1516

Штукатурка минеральная декоративная CERESIT CT 35, зерно 2,5 мм (под окраску)

кг

4,19

4,30

04.3.02.09-1517

Штукатурка минеральная декоративная CERESIT CT 35, зерно 3,5 мм (белая)

кг

4,75

4,88

04.3.02.09-1518

Штукатурка минеральная декоративная CERESIT CT 35, зерно 3,5 мм (под окраску)

кг

4,50

4,62

04.3.02.09-1519

Штукатурка минеральная декоративная CERESIT CT 36 «структурная» (белая)

кг

5,91

6,06

04.3.02.09-1520

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 1,5 мм (белая)

кг

6,49

6,65

04.3.02.09-1521

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 1,5 мм (под окраску)

кг

5,77

5,92

04. 3.02.09-1522

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 1,5 мм (цветная)

кг

5,17

5,30

04.3.02.09-1523

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 2,5 мм (белая)

кг

5,86

6,01

04.3.02.09-1524

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 2,5 мм (под окраску)

кг

4,52

4,64

04.3.02.09-1525

Штукатурка минеральная декоративная CERESIT CT 137 «камешковая», зерно 2,5 мм (цветная)

кг

6,11

6,26

04.3.02.09-1526

Штукатурка фасадная декоративная типа «BOLIX MPKA15DM»

кг

8,81

9,02

04.3.02.09-1527

Штукатурка декоративная фасадная CAPAROL: Mineral-Leichputz 134

кг

12,74

13,03

04. 3.02.09-1528

Штукатурка декоративная фасадная CAPAROL: Mineral-Leichputz 139

кг

6,23

6,39

Праймер за производството на MDF естон. Боя за MDF

Здравейте всички! В това не е голяма статия, да поговорим Какво е почвен изолатор. Речта ще отиде професионалист почвен изолатор за MDF .

Почвен изолатор — почвата е предназначена за използване като изолационна почва при пигментирани полиестерни и полиуретанови системи на покривни продукти от MDF, за да се предотврати абсорбиране и повдигане на купчина.

В практиката си срещнах компания, която или фундаментално, или не знам, или поради спасяването на пари, избягвайте тази почва по време на рисуването. Или излива ги като обикновена почва … :).

Да се \u200b\u200bсправим

защо се нуждаете от тази почва?

възможно ли е да се прави без него?
и

Как да работим с него?

Преди да се занимавате, бих искал да обясня защо е по-малко вероятно да пиша в блога . .. Мислите са приключили? Не за писане на статии? мързел? Не, всичко е в ред и мисли и теми и мързел … всичко е там, просто се случи, че трябва да променя мястото на пребиваване и работа. Мисля, че вече в някои статии се споменава, че се преместих … добре, с жилища всичко е ясно тук, но ето работата … Трябваше да стоя красива. Между другото, написах статия по темата «Как да си намерим работа»

Работно море, просто изберете нужда нормално. Ние ще работим в една седмица на компанията, разбираш ли, че не всичко изглежда толкова добре, колкото изглежда първо, търсите нов … и така няма да намеря нещо подходящо за нещо … изразходват нерви, сили, пари и най-важното … да, трябва да направите вдъхновение от реални заповеди, поставяйки снимка в блога … сега намерих голяма фирма, която изглежда е доволна (Пах Пах Пах, както и аз, аз няма да изгладя) Надявам се да вляза в обичайния ритъм на работа и писане на статии … за да не пропуснете свежи статии, препоръчваме да се абонирате Новини за моя блог

Е, добре, разбира се, чудесно, но нека поговорим за почвата . ..

Защо се нуждаете от тази почва?

Изолаторът на почвата е предназначен за предотвратяване на поглъщане на абсорбция и натрупване. Това е, преди да се прилага основната основа в съответствие с правилата на финалната система на МДФ, е необходимо да се покрие продукта с изолационен слой. В противен случай пигментът ще падне и ще падне главно в краищата и местата на фрезоване …

Мога да добавя от себе си, че благодарение на изолатора можете да спестите на слоевете на пигментната почва …

Без да причиняват изолатор, за да се постигне желания резултат, той ще трябва да покрие поне един слой от основната почва.

Възможно ли е да се прави без него?

Мога! Но! Как вече пиша по-горе купчина, абсорбция, излишък от основната почва и загуба на време Вие получавате …

Имаше време, когато лидерите настояват вместо изолатора да използват полиуретанова почва … всичко беше добро по отношение на качеството на финала, но те бяха сигурни, че е в стотинка . ..

Как да работим с него?

Както при всеки друг LKM. Разглеждаме спецификацията към нея. Каква е техническата специализация за LKM и как да се използва тя може да бъде прочетена чрез преминаване през тази връзка.

Ние намираме смесителна формулировка, пратеник, обвинение към глупостите за завесата, за който пистолетът да използва за завесата тук , покрийте продукта.

Ето момента! Изолаторът не се нуждае от прекалено много, той няма никакъв смисъл да се налива в дебел филм, той трябва да абсорбира краищата, където най-силният и абсорбира и повдига купчината, това е достатъчно.

Още веднъж не е необходимо да изливам пет слоя, преди филмът да се появи!

Ще се опитам да обясня: MDF е хартия, като всеки хартията поглъща влага. Почвата е влага … когато се прилага, стяга външния слой на MDF и поради високата скорост на сушене, тя впечатлява само няколко милиметра от външния ръб, съответно, просто променя структурата на MDF до по-плътна, На мястото на пропика . .. това не позволява, че е напоена в основната за изолационната почва.

Винаги казваме, че всички сме различни и всички възприемат информацията по свой собствен начин … някой от движение, с половин дума, и някой изглежда е ясен, но за холистична картина на нещо, което липсва … като вариант на това обяснение

Шлифовъчен изолатор

В една компания видях като човек (по пътя много добър художник) смилане на фасадата на MDF мелници след покритието с изолатор. Моето мнение е възможно, но отново какво е точката? Само за да даде почит на обезпокочението и байпяруемостта в работата …

Ние приемаме череша и на пътя …

На това аз завършвам статия … както обикновено чакам вашите коментари … участват в месечните и получават награди!

Много чудо: Възможно ли е да нарисувате MDF у дома и защо е необходимо? Първата част от въпроса ще бъде утвърдена. Наистина, можете да рисувате панела със собствените си ръце. Но трябва незабавно да направите резервация: ако няма да има камера за боя, резултатът не винаги е идеален. И процедурата за оцветяване е необходима поради следните причини:

  1. Покритите боя са по-устойчиви на високи температури и влажност. Следователно те могат да се използват в кухнята и в банята, където те могат да изпълняват различни роли.
  2. Чрез декориране е възможно да се разнообрази тъпата интериор, освежи вида на стаята. Салонът е избран въз основа на дизайнерските идеи.
  3. Необходими са и картини от MDF, за да се удължи живота им.

Живопис MDF позволява не само да се разнообрази скучният интериор, но и да удължи живота на продукта

Разбира се, тази опция има някои недостатъци. Например, тази процедура понякога е много по-скъпа от използването на декоративни филми. В допълнение, повърхността става склонна към избледняване.

Избор на материали за оцветяване

По принцип всички бои за МДФ са избрани, като се вземат предвид състава на материала. И това е, преди всичко, малка дървесна фракция, което означава, че решенията за боя за дърво са подходящи за работа. Но за да се получи наистина висококачествено покритие, препоръчително е да се прилагат специални смеси.

При избора на материали за боядисване на МДФ, си струва да обръщате внимание не само на цвета, но и за целта на боята

Полиуретанов емайл

Да се \u200b\u200bдаде предимство на този материал след следните причини:

  • Покритието се получава чрез устойчиви на износване, издържат на ефектите на домакинските химикали.
  • Решението няма неприятна миризма, която ви позволява да извършвате работа в тесни домашни условия.
  • Сместа се оставя с помощта на пръскачка, валяк и пискюли.
  • Живопис MDF емайла е направен самостоятелно, такава процедура не изисква професионални умения.

Естествено, избора на този материал, обърнете внимание на производителя. Тя трябва да бъде добре позната марка, която се продава в специализирани магазини. Чрез закупуване на стоки на неизвестен производител, вероятността да се направи фалшив е страхотен.

Бакшиш! Ако няма възможност да изберете полиуретанов състав, тогава обърнете внимание на алкидните емайли и бои (масло и акрил).

Избор на боя, трябва да обърнете внимание на производителя

Лак

По този начин въпросът как да се рисува MDF панела вече не е проблем. Но настъпи друга дилема — повърхността се нуждае от допълнителна защита, как може да се направи това?

Наистина, за да се увеличи съпротивлението на механични ефекти, предпазвайте от химични съединения — използвайте лак. И за такава работа, двукомпонентен полиуретанов състав, който притежава всички желани параметри, е особено подходящ.

Живописните стадии и технологии

Процедурата за рисуване на МДФ със собствените си ръце се извършва на няколко етапа. Те могат да бъдат разделени, както следва:

  1. Шлайфане.
  2. Шпакловка.
  3. Подложка.
  4. Оцветяване.
  5. Лапретиране (патиране).

Изпълнението на всеки етап — служи като ключ към факта, че резултатът е толкова замислен.

Смилане

Работата започва с повърхност на повърхността. Това е по-скоро отнемащо време събитие, което трябва да бъде точно.

Панелите са групирани от шкурка с зърнести от 120 до 240 единици. Процесът се извършва на няколко етапа и различни материали. Необходимо е да се направи всичко много внимателно, без да се задържа дълго време в един сайт. Тази процедура се извършва, за да се премахнат малките нередности, както и да се отстрани малка купчина, която е покрита с цялата повърхност.

MDF процедурата за шлифоване ви позволява да се отървете от малки нередности на повърхността на плочата

На бележка! Ако на предната страна има фрезови места, те са по-добре да не ги докосват. Вероятността е вероятната, която шкурка изглажда ъглите на модела.

Shpalan

Филмът на MDF под живопис има за цел да коригира съществуващите недостатъци на панела. Това се случва, когато се смила или поради неправилно съхранение, на повърхността се появяват пукнатини или вдлъбнатини. За да ги скриеш, сложете лайна. Разбира се, ако няма такива проблеми, тогава този етап липсва.

Самата технология изглежда така: акрилната смес се прилага спретнато в желаната област и се изравнява с гумена шпатула. След сушене се определя.

Подложка

Грундирането на повърхността на MDF плочата е по-добре да се изпълнява с помощта на колапс, след това грундният слой пада равномерно

Този етап е задължителен. Обикновено се разделя на два процеса:

  • Прилагане на първия слой на грунд
    • Това се прави с помощта на спрей, така че приготвяте стаята и място за работа. По-добре е да затворите останалите предмети с целофанов филм.
    • Сместа се разпръсква по цялата повърхност на панела с равномерен слой. Това се прави, за да се повиши оставащата купчина и да се намали абсорбцията на основни материали.
    • След това, когато печката изсъхне, тя се подлага на смилане с плитка шкурка.
  • Покритие от втория слой
    • Вторият слой се прилага за осигуряване на резултата и отстраняване на останалите недостатъци.
    • Сушенето трябва да отнеме около ден, след което, боядисано с праймерния панел, е пълнен.

Оцветяване

Възможно ли е да рисувате MDF с четка и ролка? Да, но трябва да се направи много внимателно. Вероятността е голяма, че ще има развод и зарове на повърхността. Ето защо най-добре е да използвате опората.

Самата технология прилича на грундиране. Боята се прилага в няколко слоя, всеки от които е предварително изсушен. Важно е да се постигне отличен резултат, така че сместа започва да се пръска от милилитирани зони до ръбовете и след това преминават и диагонално. Много по-удобно за боядисване на гладките панели.

За боядисване MDF можете да използвате четки и ролки, но за да получите равномерен слой е по-добре да използвате опорацията

На бележка! За да се разбере времето за изсушаване на решението и неговото количество подробно, е необходимо внимателно да се проучи инструкциите на производителя. И също изберете желания режим на работа за пръскачката.

Ако искате под старото

Ако изглежда, че желанието дава на повърхността по-изразен външен вид, това е малко от него, след това прибягвайте до патинг. Препоръчително е да направите, когато има снимки и модели.

Патината се прилага по този начин:

  • в избраната зона се пропуска гъба, потопена в сместа;
  • оставете до пълно сушене;
  • боядисан парцел;
  • вграждане на краен етап.

Ефектът от изкуствено образуване може да бъде създаден независимо, прибягващо до патинг на повърхността.

Лаковка

Процедурата се извършва съгласно инструкциите:

  1. Лак се подготвя за употреба.
  2. Първият слой се прилага със скорост от около 150 грама на квадратен метър.
  3. След като изчака, когато първият слой ще изсъхне добре, наложи нов слой.
  4. Повторете процеса на сушене.
  5. Започнете окончателното смилане. Първо, на повърхността преминава шкурка с голямо зърно, след това използвайте по-малко. За да избегнете подвижните бучки, мястото се напръсква с вода.
  6. Панелът е оставен в продължение на няколко дни (от 4 до 7) и са полирани. За да направите това, по-добре е да приложите инструмента за електрозахранване.

Има много съвети за това как да рисувате MDF. Основното е да следвате ясния план и да следвате точността.

Днес MDF се счита за популярен и относително достъпни материали, без които се извършва производството на кухненски панели и различни мебели. В същото време често се провежда картината на MDF, което прави фасадата по-гладка и износоустойчивост. В допълнение, за сметка на живопис, панелите получават по-дълбок и ярък цвят, който може да бъде избран под мебелите ви.

Обикновените MDF панели могат да бъдат направени за декориране на интериора, просто ги боядисване

Предимства и недостатъци на картините MDF панели

Живописните повърхности, направени от MDF, се правят не само с декоративни, но и със защитна цел. Основните предимства на панелите за рисуване са сами:

  1. Стабилността на покритието на въздействието на повишени температури, което го прави дори горещи ястия на кухненската повърхност.
  2. Висококачествената живопис MDF емайла ви позволява да направите фасадата по-рафинирана и оригинална, като я дадете уникален дизайн. Например, можете да украсите мебелите си в интересен декор под формата на перли, перла, металик и т.н. За да направите това, към боята се добавят различни пълнители.
  3. Безопасност за здравето, тъй като към него се прилагат само висококачествени боя материали.

Боядисани MDF панели не само изглеждат по-добре, но и по-надеждни и издръжливи

Недостатъци на картините MDF панели:

  • по-висока цена в сравнение с филмовото покритие;
  • когато се използва не най-висококачествената боя, боядисаната фасада може да бъде разтопена под влиянието на слънчевите лъчи.

Модерни технологии Живопис MDF панели

Правилната и висококачествена живопис трябва да се извършва в съответствие с всички правила на технологичния процес. За да работите, имате нужда от боя, грунд за дърво или полиуретанов разтвор, както и лак.

За боядисаната фасада изглежда красива и не се разваля с времето, необходимо е да се спазват определени температурни условия. Най-добре е, ако всички процеси ще преминат при температура от около двадесет градуса. В същото време влажността на въздуха трябва да бъде от 50 до 80%. Съдържанието на влага на дървените панели трябва да бъде 8-15%.

Преди да нанесете материали за боя, те трябва да бъдат филтрирани с помощта на филтър с 50-100 μm. Препоръчително е да се филтрира два пъти, ако боята се съхранява повече от две седмици.

Избор на оборудване за боядисване

За да извършите картината на MDF със собствените си ръце, е желателно да имате стая най-малко 40 квадратни метра, оборудвани със специална камера в боядисване и място за смилане на повърхности. Освен това трябва да се предвиди място за съхраняване на дървени заготовки и готови панели.

Температурата в помещението, в която ще бъдат оцветени фасадата или вътрешните повърхности, трябва да има поне двадесет градуса. Камерата за боядисване е най-добре оборудвана с екстракт и въртящ се плот. Стаята за сушене на готовите части трябва да има стелажи. Място, където възнамерявате да извършите шлайфане, най-добре е да се оборудват надеждни прахосмукачки.

Съвременната технология живопис осигурява прилагане на материали и праймери, използващи пневматичен спрей с дюза 1.5-2 mm и приемник на приемници най-малко от 80 литра. Ако се използва, той се прилага с помощта на пръскачка директно на повърхността. Смилащите части са най-добре да се извърши вибрационна машина за смилане. Полиране се извършват от ъглова шлифовъчна машина.

Етапи на рисуване

Подготвителен етап

На подготвителния етап трябва да се обърне голямо внимание на обработката на печката. За да третирате повърхността под гласа, трябва да избягвате повдигането на купчина и премахване на релефни в производствения процес.

Фасадата на МДФ трябва да бъде гасирана при максимален оборот, който ще избегне повдигането на купчина. Тъй като слоят на боядисване на боя е много тънък тук, желателно е да не оставят посочените ъгли, които могат лесно да бъдат свалени. За обработката на ъглите е най-добре да се използва ръбната мелница с радиус от около 3 mm.

За качествено замърсяване на фасадата на МДФ е необходимо да се отстрани повърхностният защитен слой от цялата повърхност. За тези творби, шлифовъчният апарат на ексцентричен тип е най-добър. За обработката на комплексните завои е желателно да се използва шкурка. Ако се приеме, че рисува повърхностите на MDF, включително няколко композитни елемента, след това задни слорета са по-добри до високо с праймера, за да запълнят порите.

Праймерни повърхности

На първия етап най-проблематичните релефни зони са грундирани. След това се извършва грубовете на панела. На последния етап цялата фасада е напоена. Прайменният пистолет трябва да се прилага първо за разтвора, а след това напречно. В същото време всеки следващ слой е насложен на предишния с 50%. Това е не само грундът, но и самата картина.

Най-ефективната технология за прилагане на почвата осигурява два етапа. Първият етап е да се използва разпръскващ колапс, който се прилага от слой от изолационен грунд. Тя трябва да попречи на купчината да повдигне и абсорбира следните слоеве боя. След това трябва да дадете на почвата да изсъхне и полира повърхността на хартията на емблемата P320-400.

Вторият етап от праймера е, че е необходимо да се прилага полиуретанова почва и да се приготви на най-малко 10 часа. След това повърхността се ухилва, в местата за смилане се използват абразивният материал на скоч-блит.

За смилане след прилагане на почвата се препоръчва да се използва аромата с числото P320

Етапска живопис

За да се боядисва фасадата на MDF до високо качество, е необходимо да се използва пистолет за пръскане с параметри на потока на боя 60-200 гр. / Кв.. М. Всички други параметри на устройството са зададени в зависимост от вида на използваното боя и лак. В това отношение, преди да боядисвате фасадата под гласа, трябва да изглеждате добре в инструкциите за използване на боя.

Боядисване на влажна технология

След грундния етап, сушенето се произвежда при температура не по-висока от 35 градуса. Периодът на сушене средно е пет часа. Мокрият метод на боядисване се извършва чрез прилагане на смес с дебелина от 120 до 140 цт. Препоръчително е да се използват полиуретанови бои и лакови покрития.

Боята се прилага с помощта на пръскачка за множество налягане. Възможно е да се прилага в два слоя, само преди покритие от втория слой, повърхността трябва да бъде извадена. В същото време дебелината на всеки от слоевете не трябва да бъде повече от 120 микрона. На следващия етап няколко слоя полиестер или полиуретан се нанасят върху MDF плоча, едновременно с междинно смилане. Крайният слой на лъскав емайл трябва да бъде полиран.

При прилагане на сложни състави на бои и лакове с различни специални ефекти, те трябва да се разбъркват добре. Необходимо е да се уреждат детайлите на пейзажа в дъното на банката.

Освен това е необходимо да се осигури леко преминаване на декоративни добавки върху дюзата на пистолета.

При оцветяване и покритие с лак повърхности от MDF трябва да се вземат, за да се гарантира, че прахът, насекомите или други боклук не попадат върху него. За да ги премахнете от боядисаната повърхност, трябва да имате пинсети с вас. Ако сте открили последиците от грунд или боя, тогава те трябва да бъдат елиминирани от канцеларския нож и шкурка.

Лесно можете да премахнете грешки, парчета мръсотия и др.

Прахообразен микс за боядисване

Сух начин на боядисване е да се прилага специална боя, която се нарича прахообразна смес. Техниката включва разпръскване на сухи микрочастици върху подготвената повърхност. След това нанесената боя се нагрява, докато започне разтопена. В резултат на това се образува практически перфектна гладка повърхност.

Изсушаване

Последният етап на всяка картина е сушене на панели. Тази процедура следва да се извършва при определени условия. По-специално, температурата на въздуха трябва да бъде не повече от 50 градуса, а влажността е по-малка от 80%.

Продължителността на сушенето в много отношения зависи от условията на околната среда. Като правило ще отнеме от 5 до 10 часа, за да завърши сушенето. Като цяло, колкото по-малка е влажността и температурата, толкова по-бързо, mdf плаката изсъхва.

Заключение

Така за висококачествена живопис, MDF плаките трябва да се наблюдават всички необходими условия. Този процес се състои от няколко етапа, като смилане, грунд, боядисване и сушене.


MDF панелите са строителен материал, предназначен за завършване на помещенията, фасадни фасади на мебелите или стените на кабинета, е направено от дървесни чипове с ниска или средна дебелина. Детайлите се считат за екологично чист елемент на финала, тъй като по време на производството им не се използват синтетични лепила, а естествената дървесна смола се използва, което надеждно фиксира всички слоеве на продукта и образува едно цяло число. МДФ панелите имат средна и ниска плътност, в зависимост от броя на слоевете и дървения състав. С течение на времето, по време на експлоатацията на тези части, тяхната повърхност може да получи драскотини, покритието губи гланц или в резултат на това, целостта на целия панел е нарушена и появата на цялото покритие става грозно. В този случай всеки собственик е изправен пред въпроса: как да се актуализира фасадата на панела, без да ги променя напълно?

Тази статия описва възможността за боядисване на такива продукти като MDF стенни панели, възможно ли е да се рисува МДФ, както и процеса на извършване на такава работа у дома.

Причини за образуване на дефекти

Съществуват редица причини, за които може да е необходима картината на MDF панелите, те включват:

  1. Механични увреждания на повърхността в резултат на удряне на остър предмет или друг материал. Горният слой на MDF панела се състои от ламинирана или проста хартия с приложена към нея боя, когато е изложена на твърд предмет, филм е разкъсващ, който разклаща сърцевината на целия продукт;
  2. Изгаряща боя, загуба на цветна яркост. Тази деформация се получава от ефектите на ултравиолетови лъчи и атмосферния въздух, който съдържа малко количество влага. С течение на времето покритието става матово, губи блясък и първоначален вид;
  3. Температурните разлики също влияят отрицателно на външното състояние на повърхността на MDF панела, тъй като вътрешната структура се състои от дърво, което абсорбира влагата от атмосферата и е напомпана в цялата област. По време на увеличаването на температурата на МДФ изсъхва и в същото време може да се пропука, освен лепилото, съдържащо се в панела, влагата губи своите способности, което води до откъсване на хартия, ламиниране и чипове.

Тези причини за деформации водят до неприятна гледка към цялата повърхност и нарушаване на общия дизайн на стената. В случай на тези дефекти можете да нарисувате MDF панелите, след като сте извършили редица подготвителни процедури, но си заслужава да се разбере, че картината на частите със собствените си ръце у дома носи резултат, който се различава от преработката на бои в производството .

Процеса на боядисване на MDF панели

Преди да отговорите на въпроса, как да рисувате MDF панелите, трябва да разберете състава на този продукт. MDF плочата, стената или фасадата се състои от няколко слоя компресирана хартия и дървени стърготини, ламинирани с прозрачен или цветен филм от предната страна. Най-често това е най-големият слой, който е повреден и носят, така че при планирането, актуализацията на МДФ трябва да бъде приготвена за посочените видове покрития.

За да подготвите MDF панела у дома, ще ви трябва:

  1. Шкурка за приготвяне на повърхността и отстраняване на гланц или лак;
  2. Разтворител за обезмасляване на повърхността от лепило и течни остатъци;
  3. Суха кърпа или друга тъкан без купчина.

Тези материали са необходими за предварително обработване на MDF панели под боядисване и запечатване на пукнатини и драскотини върху ламинат.

Цялата работа трябва да се извършва в съответствие с алгоритъма на действията. На първия етап е необходимо да се залепите панела с шлайфане с плитка фракция, това може да се извърши ръчно или използване на пневматичен инструмент. Важно е да се спазят технологията за отстраняване на лак, да се предотврати прегряване на повърхността или образуването на големи пързалки върху ламинат. Повърхността на фибустирността е под декоративен филм, така че при шлифоване е необходимо да се следи внимателно дебелината на горния слой, така че да не го изтрие. След тази процедура покритието ще спре блестящо и ще стане грубо, леко грабежи.

След това трябва да почистите всички пукнатини и чипове от мръсотия и прах, както и да почистите ръбовете си. Всички нередности, ако е необходимо, се поддържат със специална шпакловка, която образува едно цяло с базата на панела, тя трябва да бъде подравнена и с шкурка.

След като повърхността се обработва и подравнява, е необходимо да се изтрие със суха кърпа и да обезмаслява химическия разтворител, който измества и изпарява цялата вода, измийте праха и мръсотията.

На следващия етап се извършва най-голямото покритие на специална боя, тя има зърнеста текстура и може да се прилага с помощта на сгъстен въздух или прост пискъл. Тя може да покрие повърхността на няколко слоя, като междинно смилане, докато се достигне необходимата гладкост.

След това основната боя се приготвя и се смесва и се смесва добре, така че всички елементи да се смесват помежду си. Можете да рисувате панела за боя на MDF, ръчно или специален пневматичен пистолет, но това изисква инсталация на компресор и сепаратор в влага вода. Съставът се прилага с плавни движения в два слоя: първата — в основната посока, втората — по цялата дължина на частта. Така се предотвратява образуването на включвания и мастила на боята.

Крайната стъпка ще бъде обработката на горния хартиен дървен слой на панела с прозрачен лак. Тази процедура не се изисква, но след като се осъществява от повърхността на МДФ, продуктът става лъскав, горният му слой изглежда актуализиран и появата на цялата структура се възстановява.

За ваша информация. Важно е да се спазват интервалите на изсушаването на елементите между слоевете на почвата, боя и лак, тъй като в противен случай те ще бъдат сгънати и крекинг, те ще трябва да изпълнят цялата работа.

Как да рисувате и актуализирате MDF панелите

За MDF панели можете да използвате алкид или акрилен емайл, но при избора на боя си струва да се обмисли вида на праймера, работните условия на панелите, както и състава на горния слой. Ако е ламинирана хартия със синтетичен, слабо абсорбиращ филм, тогава ще бъде препоръчително да се използва акрилна или водна дисперсия емайл. Тези материали са екологично чисти и перфектно подходящи за вътрешно боядисване на закрито, докато повърхността на панела ще бъде актуализирана, както и допълнително защитена от влага на агресивната външна среда.

Така, когато спазването на цялата технология на оцветяване е възможно да се рисуват MDF панелите, той става напълно решен у дома.

Видео

34438

0

Производствената технология на МДФ дойде в нашата страна от Америка тридесет години след началото на промишленото производство на материала зад океана. За външни работи плочите не се използват по няколко причини.

  1. Ужасен. Има много разновидности от нарязани дървесина с по-висока производителност на по-ниска цена.
  2. Недостатъчна физическа сила. Чрез резистентност към динамични и статични натоварвания, плочата не отговаря на изискванията на разработчиците. Лесно е да го повредим и е трудно да се замени.
  3. Чувствителност към атмосферни валежи и температурни климатични условия. Има опции за влагоустойчиви плочи, но те не са подходящи за оползотворяване на външните повърхности на стените.

MDF плочата се използва за производството на мебели и обхваща вътрешните повърхности на стените. Става дума за тези случаи, които ще говорим. Живописните фасади MDF ще се разглеждат само за затворени помещения. Отделно ще се съсредоточим върху рисуване на фасади от MDF.

Специфичният списък на марки не е необходим и е невъзможно да го направите. Ще разкажем само за сортовете и кратките характеристики на боите, като вземем предвид метода на тяхното производство. Специфични видове трябва да бъдат избрани при условията на работа на MDF плочата, дизайнерските предпочитания и финансовите възможности. Скатерът за цената и качеството е доста голям, има какво да изберем.

Вид на цветовете Кратко оперативно изпълнение
На водна основа Най-популярни за боядисване на големи повърхности, имат задоволително представяне, са напълно безопасни за живеене. Може да бъде бял и цвят, за вътрешни и външни работи.
Акрилен силикон Комбинирайте предимствата на акрилните и силиконовите бои, екологичен продукт. Инхибира микрофлората и репродукцията на мъха, те имат високи индикатори за резистентност към механични ефекти.
Силикон Тласка вода, никаква влага и излагане на високи температури не се страхуват. Повърхностите се почистват лесно от прах и мръсотия. Благодарение на високата еластичност, топлинните разширения на MDF плаки компенсират топлината.
Поливинила ацетат Някои от най-евтините се препоръчват за употреба в помещения с минимални рискове от повреда. По време на употреба е необходимо стриктно да се изпълнят производителите, в противен случай се появяват откъсвания.
Петрол Традиционни багрила, в допълнение към даването на красив външен вид, повърхностите ефективно ги предпазват от навлизане на влага. За да се увеличи адхезията, се препоръчва да се използват грундове.
Алкид Имате перфектно гладка повърхност, направена на базата на алкидни емайли. Пластмаса, устойчива на изтриване. Недостатъкът — под влиянието на пряка слънчева светлина бързо изгаря.

Преди закупуване на боя, изчислете повърхността и закупуване на материали с марж. Консумацията е посочена от производителя. Ако се препоръчва преди боядисване на повърхността, за да покриете с грунд — не опростявайте работата. Недостатъчна адхезия на боята с MDF плоча става причина за откъсвания. В резултат на това необходимостта от скъп и трудоемък ремонт.

Видове лакове за MDF

Технологията на покритието повърхностите на лака е много по-сложна, отколкото да работи с бои, но ефектът оправдава всяко усилие. По време на избора на конкретен лак е необходимо да се вземат предвид не само неговите свойства и цената, но и мястото на прилагане и експлоатационни условия. За да покриете MDF дъските, можете да използвате следните видове лакове.

Тип лак Състав и къси характеристики
Алкохол Преместване от етилов алкохол и изкуствени смоли. Цената се отнасят до ниска категория, време за сушене в зависимост от условията и дебелината на слоя 20-30 минути.
Алкид-карбамид Двукомпонентни състави, се различават по висока якост. Състои се от карбамидни и алкидни смоли, трябва да се добави втвърдител преди употреба. Те се различават по висока якост и отличен блясък.
Епоксид Двукомпонент, висока устойчивост на удар, може да има дългосрочен контакт с вода. Използвани за покриване на таблици от MDF.
Полиестер Устойчив на ефектите на агресивните химични съединения са напълно издържани на повишени температури. Многокомпонентни лакове върху полиестерна смола.
Нитроцелулоза Съставът има смоли, пластификатори и разтворители. Имат висока устойчивост на вода, полирана, механичната якост е средна.
Акрил-уретан Разбивка с вода, безопасна за здравето, с повишена адхезия с повърхности. Може да бъде за дълго време в условия на повишени температури и влажност.
Полиуретан Направени единични, дву- и трикомпонентни. Пълното време на втвърдяване до две седмици се характеризира с повишена устойчивост на износване, има коефициент на висока адхезия с целия дървен материал.
Акрил Без миризма, не е токсичен, разреден с вода. Допуска се дълъг контакт с хранителни продукти. Относно оперативните характеристики имат средни стойности.

Тази информация ще помогне при избора на лакова марка, помислете за максималния брой индивидуални фактори. Имайте предвид, че външният вид и времето на фасадите от МДФ зависи от качеството на състава.

Технологични живопис Мебелни фасади от MDF

Доста сложна работа изисква грижи, умения и търпение. Направени на няколко етапа, всеки от които значително засяга крайното качество. Картината на фасадите е много по-бърза и по-добре да се направи пистолет за пръскане, ако не е — използвайте висококачествени пискюли с мека трайна купчина.

Стаята трябва да бъде най-малко + 20 ° С, ако има много отделни елементи на фасадата на МДФ, след това помислете за техните сушене: стелажи, резервни копия и т.н. в повечето случаи, след боядисване на плочите, се препоръчва да се покрие Те са с лак, той предпазва повърхностите от увреждане, крие малки недостатъци, значително подобрява дизайнерския вид. Ваканцията е сложен процес, изисква специални инструменти и оборудване. Тъй като MDF плочите са лакирани, ние ще ми кажем по-долу, но засега ще се съсредоточим върху рисуването.

С какви критерии вече казахме на боята. За мебелни фасади можете да добавите само, че цветът на боята трябва да вземе предвид целта на мебелите и интензивността на нейната работа.

Етап 1. Приготвяне на повърхности. За мебелни фасади, с изключение на почистването от прахосмукателни повърхности, трябва да се направи окуизация на номера на елемата 150-180.

Ръчно работят за дълго време и трудно и е почти нереалистично да се постигне желаното качество. Препоръчваме ви да използвате професионална електрическа равнина оксил-взривна машина с бутообразуване или кръгова пухкава единица.

Ръбовете са зърнени със специални четиристранни гъби. Препоръчително е да се работи в респиратора. По време на смилане, не спирайте инструмента на едно място, винаги трябва да бъде в движение. Една следа трябва да бъде припокривана от следващата не по-малка от една трета ширина. Не е необходимо сериозно да натиснете шлифовъчната пола, ако на повърхността имаше проблемни зони, по-добре е да ходите отново по целия район, а да не се задълбочавате на едно място.

Практически съвети. Всяко смилане е придружено от голямо количество фин прах. Вземете всички мерки, така че да не попадне в помещенията.

Стъпка 2. Внимателно почистете повърхността от прах. Обикновените четки не могат да направят, задължително се нуждаят от мощен прахосмукачка или компресор. Проверете състоянието на детайлите, ако има остри ръбове — премахнете ги. МВФ няма голяма сила, остри ъгли определено ще се рушат.

Стъпка 3.. Покрийте повърхността на праймера. Опитните майстори препоръчват използването на два вида грунд, всеки два пъти. Възможно е примитивно с един праймер без почивка за сушене, нанесете първия слой с хоризонтални движения на колапса и следващата вертикална вертикална. Регулирайте количеството на праймера, то не трябва да се пуши на повърхността. Първият грунд се използва за защита на по-нататъшното усвояване на материалите, а вторият за подобряване на коефициента на адхезия между тях. Вторият се прилага само след пълно изсушаване на първия грунд. Консумация на грунд на квадратен метър 80-100 грама.

Практически съвети. Начинаещите към майсторите на очите са много трудни за определяне на консумацията. За да получите умението, препоръчваме да вземете малко парче MDF, да го претеглите по точните скали. Покрийте грунда и веднага претегляйте. Пробата се изчислява по-нататък и се определя увеличаването на теглото. С помощта на елементарни математически изчисления се определя консумацията на разделяне. Малко — добавете още. Сега помнете как повърхността на МДФ е покрита с оптимален слой и допълнително става същото количество.

Силно препоръчваме да работите само с пневматична пръскачка, четка никога не постига «фабрично» качество. Следи от селски специалисти винаги ще забележат. Освен това, мебелите пада на слънчевите лъчи на различни ъгли и такова осветление подобрява всички недостатъци на лицевите покрития. Незабавно обработват грундираните краища на структурите.

Ако трябва да рисувате задната страна на плочата, след това продължете само след изсушаване на лицето. Времето за сушене е посочено от производителя, но е необходимо да се направи корекция, като се вземат предвид действителните показатели за микроклимата.

Стъпка 4. Започнете смилане на почвата, използвайте специални гъби. Ако няма — вземете кърпите за миене на ястия, на обратната страна те имат залепен скоч-ярък. Този специален материал, използван за тънко смилане, не само подравнява покритието, но и оставя на повърхността на микро-подметките, които подобряват адхезията на следващото покритие. Движение произволно в различни посоки. Не се препоръчват циркулярните движения на гъба, само рет.

Стъпка 5. Плъзнете или харчите праха, оформен на повърхността. Все още е много удобно да се работи като опора — той може да припокрие захранването на боя и да се нанесе за почистване на повърхностите от прах като компресор.

Стъпка 6.. Започнете да прилагате втори тип грунд. Той е предимно бял, подобрява оперативните показатели за следните покрития. Необходимо е и примитивни два пъти с последващо смилане. Отново от праха на MDF. Алгоритъмът на действието не се различава от горната технология.

Стъпка 7. Вторият слой от праймер трябва да се полира внимателно с електрически устройства с фина кожа. Не бързайте, големите недостатъци вече ще бъдат забележими на готовия продукт. Ако няма опит с такива машини, ние силно препоръчваме практикуването на ненужни MDF сегменти. Ще научите каква сила да натиснете шлифоването на повърхността, как бързо да се движите, коя дебелина на MDF се отстранява в един проход и така нататък.

Стъпка 8. Подгответе боя. Технологията за готвене е обозначена от производителя на опаковката.

Извършете всички препоръки. Вече споменахме, че последователността трябва да бъде по-течна за работата на богопултността. Незабавно круит два пъти в напречните посоки. Вече трябва да имате практически опит при определянето на качеството на покритието и количеството боя. Консумацията на боята варира от 60-180 гр.

След сушене, покритието може да продължи с повърхностни пари. За мебелите интериори е задължителен етап. Лак не само служи като допълнителна и надеждна защита, но също така значително подобрява появата на продукти от MDF.

Покривни плочи MDF лак

Как се прави, ще кажем по-долу. Но за качество трябва да спазвате четири основни условия:

  • не използвайте евтини лакове;
  • строго наблюдавайте технологията;
  • имат необходимите инструменти и оборудване;
  • имат практиката да изпълняват сложна боя.

Опитът за извършване на такива работи и възможността за използване на инструменти, които ще получите по време на грунд и живопис продукти, работата с лак вече ще бъде много по-лесна. Количеството лак на повърхността ще може да определи окото и пулверизаторът ще «автоматично» се движи в желаните посоки и при оптимална скорост.

Етап 1. Според инструкциите, пригответе лака, скоростта на потока е около 100-150 г на квадратен метър.

Стартиране на покритието на МДФ от краищата на МДФ, поради тази технология е възможно да се сведе до минимум броят на зоните с неравна дебелина. Късмет, който леко ще падне на предната повърхност, не представлява заплаха за крайното качество.

След като първият слой е сух, обработвайте го с най-малкия абразив. Специалистите се препоръчват да се използват абразивни влакна №1200 за международна класификация. Тя може да бъде закупена в специализирани магазини.

Стъпка 2. Отстранете праха от повърхността. Проверете повърхностите на различни ъгли на изглед в стая с добро осветление. Всичко е фино — покрийте повърхността от втория слой лак. Между другото, някои фасади се препоръчват да бъдат покрити с дебелина до 0,5 мм, а за това ще трябва да увеличите броя на слоевете до пет или повече. В промишлените предприятия има различна технология, има лак незабавно на повърхността на необходимата дебелина, след което листата на конвейера се сервират в сушилните камери. У дома тази технология не се прилага.

Стъпка 3.. Качеството е задоволително — преминете към фин шлайфане и полиране на финалния слой. За тънко смилане, използвайте Velvet №1500, 2000 и 3000. Повърхността е чист, но внимателно обработва всеки номер, периодично отстранява праха.

Практически съвети. Качеството на смилане значително ще се подобри, ако повърхността е направена малко вода. Лакът няма да прегрее, по време на работа на повърхността микроразделегите се образуват от ефектите на абразивните материали. Микрокрак пречупват светлинните лъчи, повърхността става матова.

Всеки брой преминава през цялата повърхност най-малко три или четири пъти. Натискането на сила е малко по-малко, отколкото при смилане на грунд. Времето за шлайфане отнема много. Ако сте уморени — по-добре е да прехвърлите работа на следващия ден и да не спрете изобщо.

Стъпка 4. Полиране. За полиране е необходима специална полираща паста и перфектно гладък твърд кръг. Паста много, избират не проблем. Разгледайте препоръките и ги сравнете с вашите индивидуални условия. Не бързайте, непрекъснато наблюдавайте състоянието на повърхностните повърхности.

Ако имате доста голямо количество работа, ние ви съветваме да закупите специални електрически полиращи машини. Те не само ускоряват и улесняват работата, но също така значително подобряват качеството. Полиращата паста се прилага към слой със слой от приблизително 1-2 mm, не го ласкайте, докато излишната паста ще бъде изтрита независимо от под диска и ще остане на повърхността на МДФ. След това, както е необходимо, въртящият се диск улавя желаното количество материал.

Като последния етап можете да използвате повърхностите на повърхностите с съставите, осигуряващи огледален блясък.

Боядисване на фасади на икономически атаки от MDF

Споменахме, че този материал не се препоръчва за външна кожа. Но има случаи на неговото използване за временно завършване на фасадните стени на атаките на малки стари страни. Така те правят собствениците, чието финансово състояние не позволява да се придобият нови материали, за да покрият фасадите на икономическите атаки, те използват различни използвани строителни материали, включително MDF панелите.

За да се увеличи живота на структурите, препоръчваме да се боядисва външна повърхност. Не пропускайте праймера, защото цената на материала е достъпна за всички разработчици, времето за извършване на работа е донякъде и ефектът е очевиден. Тип грунд изберете с тип боя. На пакета производителят показва кой праймер трябва да се използва. Праймерът се извършва два пъти, пискът или ролката трябва да се движат в перпендикулярни указания. Ако по някаква причина е невъзможно да се постигне, тогава всеки слой се грундира поне под ъгъл. В допълнение към увеличаването на адхезията, грундът намалява потока на скъпи бои и предотвратява появата на петна от основата. Можете да рисувате с пискюли с различни размери и ролки. Но един ролките не можеха да направят, мястото на кръстовищата трябва да се боядисва внимателно с пискюли.

Етап 1. Измерване на площта на боядисаната повърхност. Вземете под внимание областта и потреблението, не купувайте боята «фона», винаги имате запас материал. Ще бъдете тихи за работа, а излишъкът винаги ще бъде полезен за производството на козметични ремонти.

Стъпка 2. Почистете повърхността на MDF от прах внимателно, е желателно да се използва прахосмукачката. Частиците от прах могат да бъдат забележими на повърхността на боята, за да ги извадят след това нереално. Ще трябва напълно да прекарамираме чинията.

Стъпка 3. Подгответе боя и инструменти. Ако материалът се съхранява за дълго време на склад, тогава съставът трябва да се смесва добре. Когато оцветявате повърхността с пулверизатор, боята ще трябва да направи леко разтворител. Какво точно да изберете, написано на опаковката. За гаранция можете да се излее преди малка боя в разтворителя. Ако боята се свива — разтворителят не е подходящ.

Стъпка 4. Вода ролката или четка в боята и започва да рисува повърхността.

Можете да приложите боя с четка или ролки

Практически съвети. Задайте четката отгоре надолу, така че ще видите капки с излишната боя и ще ги премахнете своевременно. Ако рисувате напротив, ще трябва непрекъснато да се връщате в предварително покритата област на боя, за да елиминирате потоците. Те не могат да забележат или да забравят да се върнат — ще има проблем. Ако капките се изсушат, премахването ще отнеме много време. В някои случаи те ще трябва да отрежат острието и да поправят повърхността на покритието.

Стъпка 5.. Четката нарисува местата на прилежащите, следвайте песните от вилите. В изпълнението можете да посрещнете с лошо качество на четки за боядисване, купчината им държи слабо. Така че не е оставено на повърхността, четката преди да се използва с голямо укрепване на магията за всяка чиста повърхност. Недостатъчно прикрепени косми ще излязат и няма да създават проблеми по време на оцветяването.

Стъпка 6. . Дайте първия слой да изсъхне, времето зависи от характеристиката на боята. Професионалните художници не съветват сухи, когато отворените прозорци — прах попада в стаята и се придържа към повърхността на боята.

Стъпка 7. Ако качеството на един слой е незадоволителен — прилагайте втората. Технологията е еднаква.

По време на боядисване на повърхности, различни модели и орнаменти могат да се изтеглят. За да направите това, предварително начертайте контурните линии с молив. Всеки цвят, от който се нуждаете, за да проповядвате с боядисване.

Как да премахнем старата боя

Премахване на покритието на боята не е толкова просто, много зависи от неговия състав и възможностите ви. Обмислете три метода за почистване на повърхностите на MDF.

  1. Механични. Отстраняването на покритията е направено от метална четка или шпатула. Работата е много трудна и не винаги ефективна. По този начин можете да премахнете само много стари пилинг покрития и след това да не от цялата повърхност. Много по-лесно е да се използват различни електрически машини с голям абразивен материал. Ние ви предупреждаваме, че ще има много прах, да предприемете действия, така че да не попадне в съседните помещения. За да защитите дихателните органи, трябва да използвате респиратори или маски. Шлаксът ще бъде бързо запушен, ще трябва да го промените често.

Replisome — bg.wikiwebzone.com

тази статия се нуждае от допълнителни цитати за проверка. Моля помогнете подобрете тази статия чрез добавяне на цитати към надеждни източници. Неподредените материали могат да бъдат оспорени и отстранени.
Намерете източници: „Относно“ – Новини · вестници · книги · учен · JSTOR (Юли 2018 г.) (Научете как и кога да премахнете това съобщение с шаблон)

Представяне на структурите на реплизома по време на репликация на ДНК

The реплизоме е сложна молекулярна машина, която извършва репликация на ДНК. Реплизомът първо разгръща двуверижна ДНК на две единични вериги. За всяка от получените единични вериги се синтезира нова комплементарна последователност на ДНК. Нетният резултат е формиране на две нови двуверижни ДНК последователности, които са точни копия на оригиналната двойно верижна ДНК последователност.

По отношение на структурата реплизомата се състои от два репликативни комплекса полимераза, единият от които синтезира водещата верига, докато другият синтезира изоставащата верига. Реплизомата се състои от редица протеини, включително хеликаза, RFC, PCNA, гираза / топоизомераза, SSB / RPA, примаза, ДНК полимераза III, RNAse H и лигаза.

Преглед на процеса на репликация на прокариотна ДНК

За прокариотите всеки делящ се нуклеоид (регион, съдържащ генетичен материал, който не е ядро) изисква две реплизоми за двупосочна репликация. Двете реплизоми продължават репликацията на двете разклонения в средата на клетката. И накрая, когато мястото на терминиране се репликира, двете реплизоми се отделят от ДНК. Реплизомата остава на фиксирано, средно-клетъчно място в клетката, прикрепено към мембраната, и през нея преминава ДНК на шаблона. ДНК се подава през неподвижната двойка реплизоми, разположени в клетъчната мембрана.

Преглед на процеса на репликация на еукариотна ДНК

За еукариотите в началото на репликацията в хромозомата се образуват множество репликационни мехурчета. Както при прокариотите, са необходими две реплизоми, по една на всяка репликационна вилица, разположена в края на репликационния балон. Поради значителни разлики в размера на хромозомите и свързаните с тях сложности на силно кондензирани хромозоми, различни аспекти на процеса на репликация на ДНК в еукариотите, включително крайните фази, са по-слабо характеризирани, отколкото при прокариотите.

Предизвикателства на репликацията на ДНК

Реплизомата е система, в която различни фактори работят заедно за решаване на структурните и химични предизвикателства на репликацията на ДНК. Размерът и структурата на хромозомите варират при различните организми, но тъй като молекулите на ДНК са резервоарът на генетична информация за всички форми на живот, много предизвикателства и решения за репликация са еднакви за различните организми. В резултат на това репликационните фактори, които решават тези проблеми, са силно запазени по отношение на структура, химия, функционалност или последователност. Общите структурни и химически предизвикателства включват следното:

  • Ефективно сглобяване на реплизома в началото на репликацията (комплекси за разпознаване на произход или специфични последователности на произход на репликация при някои организми)
  • Разделяне на дуплекса в водещите и изоставащи направления на шаблона (хеликази)
  • Защита на водещите и изоставащи нишки от повреда след дуплекс разделяне (SSB и RPA фактори)
  • Грундиране на водещите и изоставащи нишки на шаблона (примаза или ДНК полимераза алфа)
  • Осигуряване на процесивност (фактори на натоварване със скоби, пръстеновидни скоби, протеини, свързващи нишки)
  • ДНК репликация с висока точност (ДНК полимераза III, ДНК полимераза делта, ДНК полимераза епсилон. Всички имат присъщи ниски нива на грешки поради своята структура и химия. )
  • Коригиране на грешки (репликативни полимеразни активни сайтове усещат грешки; 3 ‘до 5’ екзонуклеазни домейни на репликативни полимерази коригират грешки)
  • Синхронизирана полимеризация на водещи и изоставащи нишки въпреки антипаралелната структура (структура на репликационната вилица, димеризация на репликативни полимерази)
  • Отстраняване на грунд (ДНК полимераза I, РНКаза Н, ендонуклеази на клапата като FEN1 или други фактори за възстановяване на ДНК)
  • Образуване на фосфодиестерни връзки при пролуки между фрагменти на Okazaki (лигаза)

Като цяло предизвикателствата на репликацията на ДНК включват структурата на молекулите, химията на молекулите и, от системна гледна точка, основните взаимоотношения между структурата и химията.

Решаване на предизвикателствата на репликацията на ДНК

Много от структурните и химични проблеми, свързани с репликацията на ДНК, се управляват от молекулярни машини, които са силно запазени в организмите. Този раздел обсъжда как реплисомните фактори решават структурните и химичните предизвикателства на репликацията на ДНК.

Повторно събрание

Репликацията на ДНК започва на места, наречени произход на репликацията. При организми с малки геноми и проста хромозомна структура, като бактерии, може да има само няколко произхода на репликация на всяка хромозома. Организмите с големи геноми и сложна хромозомна структура, като хората, могат да имат стотици или дори хиляди произход на репликация, разпространени в множество хромозоми.

Структурата на ДНК варира във времето, пространството и последователността и се смята, че тези вариации, в допълнение към ролята си в генната експресия, също играят активни роли в сглобяването на реплизома по време на синтеза на ДНК. Сглобяването на реплики в произход на репликацията е грубо разделено на три фази.

За прокариоти:

  • Образуване на пред-репликационен комплекс. DnaA се свързва с комплекса за разпознаване на произход и разделя дуплекса. Това привлича DnaB хеликаза и DnaC, които поддържат репликационния балон.
  • Образуване на прединициационен комплекс. SSB се свързва с единичната нишка и след това гама (коефициент на натоварване на скобата) се свързва с SSB.
  • Образуване на инициационен комплекс. Гама отлага плъзгащата скоба (бета) и привлича ДНК полимераза III.

За еукариоти:

  • Образуване на пред-репликационен комплекс. MCM факторите се свързват с комплекса за разпознаване на произхода и отделят дуплекса, образувайки репликационен балон.
  • Образуване на прединициационен комплекс. Репликационният протеин A (RPA) се свързва с едноверижната ДНК и след това RFC (коефициент на натоварване на скобата) се свързва с RPA.
  • Формиране на инициационен комплекс. RFC отлага плъзгащата скоба (PCNA) и привлича ДНК полимерази като алфа (α), делта (δ), епсилон (ε).

Както за прокариотите, така и за еукариотите, следващият етап обикновено се нарича „удължаване“ и по време на тази фаза се получава по-голямата част от синтеза на ДНК.

Разделяне на дуплекса

ДНК е дуплекс, образуван от две антипаралелни нишки. След Meselson-Stahl, процесът на репликация на ДНК е полуконсервативен, при което по време на репликацията оригиналният ДНК дуплекс се разделя на две дъщерни вериги (наричани шаблони за водеща и изоставаща верига). Всяка дъщерна верига става част от нов ДНК дуплекс. Факторите, които обикновено се наричат ​​хеликази, развиват дуплекса.

Хеликази

Хеликаза е ензим, който разрушава водородните връзки между базовите двойки в средата на ДНК дуплекса. Неговата подобна на поничка структура обвива ДНК и разделя нишките преди синтеза на ДНК. При еукариотите комплексът Mcm2-7 действа като хеликаза, но кои субединици са необходими за хеликазна активност, не е напълно ясно. Тази хеликаза се транслоцира в същата посока като ДНК полимеразата (3 ‘до 5’ по отношение на матричната верига). При прокариотните организми хеликазите са по-добре идентифицирани и включват dnaB, който се движи 5 ‘до 3’ върху нишката, противоположна на ДНК полимеразата.

Развиване на суперспирали и декатенация

Примери за топологични намотки, въведени по време на дуплексното размотаване и разделяне на нишките.

Тъй като хеликазата отвива двойната спирала, топологичните промени, предизвикани от въртеливото движение на хеликаза, водят до образуване на суперспирала преди хеликаза (подобно на това, което се случва, когато усучете парче конец).

Гираза и топоизомерази

Гиразата (форма на топоизомераза) отпуска и премахва намотката, причинена от хеликаза. Това се прави чрез изрязване на нишките на ДНК, позволявайки й да се върти и освобождава суперспиралата и след това да се присъедини отново към нишките. Гиразата се среща най-често нагоре от репликационната вилица, където се образуват суперспиралите.

Защита на водещите и изоставащи нишки

Изобразяване на подедината 70kd на репликационен протеин А

Едноверижната ДНК е силно нестабилна и може да образува със себе си водородни връзки, които се наричат ​​„фиби“ (или единичната верига може неправилно да се свърже с другата единична верига). За да се противодейства на тази нестабилност, едноверижни свързващи протеини (SSB в прокариоти и репликационен протеин А в еукариоти) се свързват с откритите основи, за да се предотврати неправилно лигиране.

Ако разглеждате всяка верига като „динамична, разтеглива струна“, структурният потенциал за неправилно лигиране трябва да е очевиден.

Изоставащата верига без свързващи протеини.
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Изоставащи основи на нишки
=========================================== Захарен фосфатен гръбнак

Разширена схема разкрива основната химия на проблема: потенциалът за образуване на водородна връзка между несвързани базови двойки.

Схематичен изглед на новоотделени ДНК вериги без свързващи вериги протеини.
--HH--------HH-HH--H--HH----------HH--HH--H Схема на водородната връзка
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Схема на водородната връзка
HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH Схема на водородната връзка
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Изоставащи основи на нишки
=========================================== Захарен фосфатен гръбнак

Свързващите протеини стабилизират единичната верига и предпазват нишката от увреждане, причинено от нелицензирани химични реакции.

Изоставащата верига, покрита със свързващи протеини (*), които предотвратяват неправилно лигиране.
******************************************* Свързващи нишки протеини
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Изоставащи основи на нишки
=========================================== Захарен фосфатен гръбнак

Комбинацията от единична верига и нейните свързващи протеини служи като по-добър субстрат за репликативни полимерази от гола единична верига (свързващите протеини осигуряват допълнителна термодинамична движеща сила за реакцията на полимеризация). Свързващите вериги протеини се отстраняват чрез репликативни полимерази.

Грундиране на водещите и изоставащи нишки

Както от структурна, така и от химическа гледна точка, единична верига ДНК сама по себе си (и свързаните с нея вериги, свързващи протеини) не е подходяща за полимеризация. Това е така, защото химическите реакции, катализирани от репликативни полимерази, изискват свободен 3 ‘OH, за да инициират удължаване на нуклеотидната верига. По отношение на структурата, конформацията на активните центрове на репликативни полимерази (което е силно свързано с присъщата точност на репликативните полимерази) означава, че тези фактори не могат да започнат удължаване на веригата без вече съществуваща верига от нуклеотиди, тъй като никоя известна репликативна полимераза не може да започне удължаване на веригата de novo.

Грундиращите ензими (които са ДНК-зависими РНК полимерази) решават този проблем, като създават РНК праймер върху водещите и изоставащи нишки. Водещата нишка се грундира веднъж и изоставащата нишка се грундира приблизително на всеки 1000 (+/- 200) базови двойки (един грунд за всеки фрагмент на Okazaki върху изоставащата верига). Всеки РНК праймер е дълъг приблизително 10 бази.

Едноверижна ДНК с верижно свързващи протеини (*) и РНК праймер, добавени чрез първоначални ензими (UAGCUAUAUAUA).
=========================================== Захарен фосфатен гръбнак
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Изоставащи основи на нишки
UAGCUAUAUAUA******************************* РНК праймер и верижни свързващи протеини

Интерфейсът при (A *) съдържа свободен 3 ‘OH, който е химически подходящ за реакцията, катализирана от репликативни полимерази, а конфигурацията «надвес» е структурно подходяща за удължаване на веригата от репликативна полимераза. По този начин репликативните полимерази могат да започнат удължаване на веригата при (A *).

Примаза

При прокариотите примата създава РНК праймер в началото на новоотделените водещи и изоставащи нишки.

ДНК полимераза алфа

При еукариотите ДНК полимераза алфа създава РНК праймер в началото на новоотделените водещи и изоставащи нишки и, за разлика от примазата, ДНК полимераза алфа също синтезира къса верига дезоксинуклеотиди след създаването на праймера.

Осигуряване на процесивност и синхронизация

Процесивността се отнася както до скоростта, така и до непрекъснатостта на репликацията на ДНК, а високата процесивност е изискване за навременна репликация. Високата обработваемост отчасти се осигурява от пръстеновидни протеини, наричани „скоби“, които помагат на репликативните полимерази да останат свързани с водещите и изоставащи нишки. Съществуват и други променливи: от химическа гледна точка, свързващите вериги протеини стимулират полимеризацията и осигуряват допълнителна термодинамична енергия за реакцията. От гледна точка на системата, структурата и химията на много реплисиращи фактори (като характеристиките на AAA + ATPase на отделните подразделения за натоварване със скоби, заедно с спиралната конформация, която те приемат) и асоциациите между факторите за натоварване на скобите и други допълнителни фактори, също увеличава процесивността.

До този момент, според изследванията на Kuriyan et al., Поради тяхната роля при набирането и свързването на други фактори като грундиращи ензими и репликативни полимерази, скобите и плъзгащите скоби са в основата на машината за реплизома. Изследванията са установили, че факторите на натоварване на скобата и плъзгащи скоби са абсолютно необходими за репликацията, което обяснява високата степен на структурна консервация, наблюдавана при фактори на натоварване и плъзгащи скоби. Това архитектурно и структурно запазване се наблюдава в организми, толкова разнообразни като бактерии, фаги, дрожди и хора. Това, че се наблюдава такава значителна степен на структурна консервация без хомология на последователността, допълнително подкрепя значението на тези структурни решения за репликационни предизвикателства.

Скоба товарач

Clamp loader е родов термин, който се отнася до репликационни фактори, наречени гама (прокариоти) или RFC (еукариоти). Комбинацията от матрична ДНК и праймерна РНК е посочена като „А-форма ДНК“ и се смята, че протеините за репликация със затягащо натоварване (спирални хетеропентамери) искат да се свържат с А-форма ДНК поради нейната форма (структурата на основния / малка бразда) и химия (модели на донори и акцептори на водородни връзки). По този начин, протеините за натоварване със скоби се свързват с грундираната област на нишката, която причинява хидролиза на АТФ и осигурява енергия за отваряне на скобата и прикрепването й към нишката.

Плъзгаща скоба

Изобразяване на напълно сглобена, тримерна PCNA скоба

Плъзгащата скоба е родов термин, който се отнася до пръстеновидни репликационни фактори, наречени бета (прокариоти) или PCNA (еукариоти). Притискащите протеини привличат и свързват репликативни полимерази, като ДНК полимераза III, за да удължат времето, през което репликативната полимераза остава свързана с веригата. От химическа гледна точка скобата има леко положителен заряд в центъра си, което е почти идеално съвпадение за леко отрицателния заряд на ДНК веригата.

При някои организми скобата е по-димерна, а при други организмите скобата е тример. Независимо от това, запазената архитектура на пръстена позволява на скобата да затвори нишката.

Димеризация на репликативни полимерази

Репликативните полимерази образуват асиметричен димер на репликационната вилица чрез свързване към под-единиците на коефициента на натоварване на скобата. Тази асиметрична конформация е способна едновременно да възпроизвежда водещите и изоставащите нишки и колекцията от фактори, която включва репликативните полимерази, обикновено се нарича холоензим. Въпреки това остават значителни предизвикателства: водещите и изоставащи направления са антипаралелни. Това означава, че нуклеотидният синтез на водещата верига естествено се осъществява в посока 5 ‘до 3’. Въпреки това, изоставащата верига протича в обратна посока и това представлява доста голямо предизвикателство, тъй като нито една известна репликативна полимераза не може да синтезира ДНК в посока 3 ‘до 5’.

Димеризацията на репликативните полимерази решава проблемите, свързани с ефективната синхронизация на синтеза на водеща и изоставаща верига на репликационната вилица, но тясното пространствено-структурно свързване на репликативните полимерази, докато решава трудния проблем със синхронизацията, създава друго предизвикателство: димеризация на репликативните полимерази на репликационната вилица означават, че нуклеотидният синтез и за двете вериги трябва да се осъществява на едно и също пространствено място, въпреки факта, че изоставащата верига трябва да бъде синтезирана назад спрямо водещата верига. Синтезът на изоставащата верига се осъществява, след като хеликазата развърта достатъчно количество от изоставащата верига и това «достатъчно количество на изоставащата верига» се полимеризира в дискретни нуклеотидни вериги, наречени фрагменти Оказаки.

Помислете за следното: хеликаза непрекъснато отвива родителския дуплекс, но изоставащата нишка трябва да бъде полимеризирана в обратна посока. Това означава, че докато полимеризацията на водещата верига продължава, полимеризацията на изоставащата верига се осъществява само след като достатъчно количество изоставаща верига е била развита от хеликаза. В този момент репликативната полимераза на изоставащата верига се свързва със скобата и грунда, за да започне полимеризация. По време на синтеза на изоставаща верига, репликативната полимераза изпраща изоставащата верига обратно към репликационната вилица. Репликативната полимераза се разпада, когато достигне РНК праймер. Helicase продължава да отвива родителския дуплекс, грундиращият ензим прикрепва друг праймер, а репликативната полимераза се свързва отново със скобата и праймера, когато достатъчно количество от изоставащата верига се размотае.

Колективно, водещият и изоставащият синтез на нишки се нарича „полупрекъснат“.

ДНК репликация с висока точност

Прокариотните и еукариотните организми използват различни репликативни полимерази, някои от които са добре характеризирани:

  • ДНК полимераза III
  • ДНК полимераза делта
  • ДНК полимераза епсилон
ДНК полимераза III

Тази полимераза синтезира ДНК на водеща и изоставаща верига в прокариоти.

ДНК полимераза делта

Тази полимераза синтезира изоставаща ДНК верига в еукариотите. (Мисълта да образува асиметричен димер с ДНК полимераза епсилон.)

ДНК полимераза епсилон

Тази полимераза синтезира ДНК от водеща верига в еукариотите. (Мисълта да образува асиметричен димер с ДНК полимеразна делта.)

Проверка и корекция на грешки

Макар и рядко, по време на удължаване на веригата се получава неправилна полимеризация на сдвояване на основата. (Структурата и химията на репликативните полимерази означават, че грешките са малко вероятни, но се случват. ) Много репликативни полимерази съдържат механизъм за «корекция на грешки» под формата на 3 ‘до 5’ екзонуклеазен домейн, който е в състояние да премахне базовите двойки от изложеният 3 ‘край на нарастващата верига. Корекцията на грешки е възможна, тъй като грешките на двойките основи изкривяват позицията на магнезиевите йони в подразделението за полимеризация, а структурно-химичното изкривяване на полимеризационния блок ефективно спира процеса на полимеризация, като забавя реакцията. Впоследствие химическата реакция в екзонуклеазната единица поема и отстранява нуклеотидите от открития 3 ‘край на нарастващата верига. След като грешката бъде отстранена, структурата и химията на полимеризационната единица се нормализира и репликацията на ДНК продължава. Работейки колективно по този начин, активният сайт на полимеризацията може да се разглежда като „коректор на корекции“, тъй като той усеща несъответствия, а екзонуклеазата е „редактор“, тъй като коригира грешките.

Грешките на базовите двойки изкривяват активното място на полимеразата за между 4-6 нуклеотида, което означава, че в зависимост от вида на несъответствието има до шест шанса за корекция на грешките. Функциите за откриване и коригиране на грешки, съчетани с присъщата точност, която произтича от структурата и химията на репликативните полимерази, допринасят за степента на грешки от приблизително 1 несъответствие на двойка основи на 108 до 1010 базови двойки.

Схематичен изглед на правилните базови двойки, последвани от 8 възможни несъответствия на базови двойки.
=========================================== Захарен фосфатен гръбнак
ATCG AGAC TTCG xxxxxxxxxxxxxxxxxxxxxxxxxxxx Оригинални изоставащи основи на нишки
TAGC AGGC TCAT xxxxxxxxxxxxxxxxxxxxxxxxxxxx Правилно съвпадащи бази, последвани от 8 възможни несъответствия
=========================================== Захарен фосфатен гръбнак

Грешките могат да бъдат класифицирани в три категории: несъответствия между пурин и пурин, несъответствия между пиримидин и пиримидин и несъответствия между пиримидин и пурин. Химията на всяко несъответствие варира, както и поведението на репликативната полимераза по отношение на нейната активност за откриване на несъответствие.

Репликацията на ДНК на бактериофаги Т4 при инфекция на Е. coli е добре проучена система за репликация на ДНК. По време на периода на експоненциално нарастване на ДНК при 37 ° C, скоростта на удължаване е 749 нуклеотида в секунда. Скоростта на мутация по време на репликацията е 1,7 мутации на 108 базови двойки. По този начин репликацията на ДНК в тази система е едновременно много бърза и много точна.

Отстраняване на грунд и лигиране на ник

Има два проблема след синтеза на водеща и изоставаща верига: РНК остава в дуплекса и има прорези между всеки фрагмент на Okazaki в изоставащия дуплекс. Тези проблеми се решават от различни ензими за възстановяване на ДНК, които се различават в зависимост от организма, включително: ДНК полимераза I, ДНК полимераза бета, РНКаза Н, лигаза и DNA2. Този процес е добре характеризиран при прокариоти и много по-слабо характеризиран при много еукариоти.

По принцип ензимите за възстановяване на ДНК допълват фрагментите на Okazaki чрез различни средства, включително: ексцизия на двойки основи и 5 ‘до 3’ екзонуклеазна активност, която премахва химически нестабилните рибонуклеотиди от изоставащия дуплекс и ги замества със стабилни дезоксинуклеотиди. Този процес се нарича „узряване на Okazaki фрагменти“ и лигазата (виж по-долу) завършва последната стъпка в процеса на зреене.

РНК-ДНК дуплекс с рибонуклеотиди, добавени от първоначален ензим (-) и дезоксинуклеотиди, добавени от репликативна полимераза (+).
=========================================== Захарен фосфатен гръбнак
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Оригинални изоставащи основи на нишки
UAGCUAUAUAUACGTCGATCTTCGAATTTATATACGATCGTAC С праймера новосинтезираните основи са комбинация от урацил, аденин, тимин, цитозин и гуанин.
=========================================== С грунда основата на захарния фосфат е направена от рибоза и дезоксирибоза.
------------+++++++++++++++++++++++++++++++ — обозначава рибонуклеотид и + показва дезоксинуклеотид

Отстраняването на грунда и лигирането на ник може да се разглежда като процес на възстановяване на ДНК, който произвежда химически стабилен дуплекс без грешки. До този момент, по отношение на химията на РНК-ДНК дуплекс, в допълнение към присъствието на урацил в дуплекса, присъствието на рибоза (която има реактивен 2 ‘OH) има тенденция да направи дуплекса много по-малко химически стабилен отколкото дуплекс, съдържащ само дезоксирибоза (който има нереактивен 2 ‘H).

ДНК полимераза I

ДНК полимераза I е ензим, който възстановява ДНК.

РНКаза Н

РНКазата Н е ензим, който премахва РНК от РНК-ДНК дуплекс.

Лигаза

След като ДНК факторите за възстановяване заместват рибонуклеотидите на праймера с дезоксинуклеотиди, остава една празнина в захарно-фосфатния скелет между всеки фрагмент на Okazaki в изоставащия дуплекс. Ензим, наречен ДНК лигаза свързва празнината в гръбнака чрез образуване на фосфодиестерна връзка между всяка празнина, която разделя фрагментите на Okazaki. Структурните и химични аспекти на този процес, обикновено наричани „ник превод“, надхвърлят обхвата на тази статия.

Схематичен изглед на новия, изоставащ дъщерен ДНК дуплекс на веригата е показан по-долу, заедно със захарно-фосфатния скелет.
=========================================== Оригинална изоставаща верига дезоксирибоза-фосфатна основа
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Оригинални изоставащи основи на нишки
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC След активността на ДНК фактора за възстановяване основите са аденин, тимин, цитозин и гуанин.
========|=============|============|======= След активността на ДНК фактора за възстановяване, гръбначният стълб е чист дезоксирибоза-фосфат с резки между всеки фрагмент от Okazaki.
Готовият дуплекс:
=========================================== Оригинална изоставаща верига дезоксирибоза-фосфатна основа
ATCGATATATATGCAGCTAGAAGCTTAAATATATGCTAGCATG Оригинални изоставащи основи на нишки
TAGCTATATATACGTCGATCTTCGAATTTATATACGATCGTAC Новосинтезирани основи
=========================================== Новосинтезиран деоксирибозо-фосфатен скелет без Okazaki фрагменти.

Репликационен стрес

Репликационният стрес може да доведе до блокирана вилица за репликация. Един тип репликативен стрес е резултат от увреждане на ДНК, като междуверижни кръстосани връзки (ICL). ICL може да блокира прогресията на репликативната вилица поради неуспех на разделянето на веригата на ДНК. В гръбначните клетки репликацията на съдържащ ICL шаблон за хроматин предизвиква набиране на повече от 90 фактора за възстановяване на ДНК и поддържане на генома. Тези фактори включват протеини, които извършват последователни разрези и хомоложна рекомбинация.

История

Катрин Лимон и Алън Гросман показаха, че използват Bacillus subtilis че реплизомите не се движат като влакове по коловоз, а ДНК всъщност се подава през неподвижна двойка реплизоми, разположени в клетъчната мембрана. В експеримента си реплизомите през B. subtilis всеки от тях е маркиран със зелен флуоресцентен протеин и местоположението на комплекса се наблюдава в репликиращи се клетки с помощта на флуоресцентна микроскопия. Ако реплизомите се движеха като влак по пистата, протеинът полимераза-GFP щеше да се намери на различни позиции във всяка клетка. Вместо това обаче във всяка репликираща се клетка реплизомите се наблюдават като отделни флуоресцентни огнища, разположени в или близо до средната клетка. Клетъчната ДНК, оцветена със синя флуоресцентна боя (DAPI), очевидно заема по-голямата част от цитоплазменото пространство.

Препратки

Допълнителна информация

външни връзки

  • ДНК + реплизома в Националната медицинска библиотека на САЩ Медицински предметни рубрики (MeSH)

ПРАЙМЕР ДЛЯ НАНЕСЕНИЯ БЛЕСТОК GLITTER PRIMER 01

ОСОБЕННОСТИ:
Cпециальное средство для более стойкого нанесения блесток.

ПОДХОДИТ ДЛЯ: лица и тела.

СПОСОБ ПРИМЕНЕНИЯ:
Нанесите с помощью кисти на место, куда необходимо будет нанести блестки. Затем, с помощью кисти, нанесите поверх блеск.

РЕЗУЛЬТАТ: стойкий эффект, плотное и сияющее покрытие.

Объём: 10 мл.

Water/Aqua/Eau, Beeswax/Cera Alba/Cire d’Abeille, Stearic Acid, Octyldodecanol, PVP, Butyrospermum Parkii (Shea) Butter, Butylene Glycol, Acrylates/Octylacrylamide Copolymer, Silica, Aminomethyl Propanol, Tocopheryl Acetate, Jojoba Esters, Tocopherol, Caprylyl Glycol, Phenoxyethanol. MAY CONTAIN / PEUT CONTENIR (+/-): Mica, Titanium Dioxide (CI 77891), Iron Oxides (CI 77491, 77492, 77499).

WATER/AQUA/EAU — Вода.
BEESWAX/CERAALBA/CIRED’ABEILLE. Пчелиный воск — восковая пленка удерживает влагу, помогает уменьшить чувствительность кожи, оказывает противовоспалительное и заживляющее действие, смягчает верхний слой кожи, но при этом не смешивается с собственными липидами и не создает риск появления комедонов при повышенной жирности кожи.
STEARIC ACID — Эмолент.
OCTYLDODECANOL — Эмолент.
PVP— Текстурообразователь, загуститель.
BUTYROSPERMUMPARKII (SHEA) BUTTER — Увлажняющее. Масло карите быстро впитывается и усиливает барьерные свойства кожи, предохраняя ее от потери влаги. Разглаживающее. Масло карите глубоко смягчает кожу, уменьшает глубину морщин, избавляет от чувства стянутости кожи. Противовоспалительное. Масло карите устраняет раздражение и шелушение на коже. Регулирующее. Масло карите регулирует содержание жидкости в организме, избавляет от отечностей, синяков и морщин в области вокруг глаз. Защитное. Неомыляемые жиры, входящие в состав масла карите, являются природными УФ-фильтрами и предохраняют кожу от вредного воздействия солнечных лучей.
BUTYLENEGLYCOL — Увлажняет.
ACRYLATES/OCTYLACRYLAMIDECOPOLYMER — Эмолент.
SILICA— Силика (Silica; диоксид кремния) — гладкий, шелковистый порошок, используется в косметике для гладкости. Кожа визуально выглядит более ровно
AMINOMETHYL PROPANOL -Эмолент.
TOCOPHERYL ACETATE— Витамин Е, мощнейший антиоксидант, а значит этот витамин эффективно защищает кожу от старения и повреждающих факторов окружающей среды.
JOJOBA ESTERS — Эфир жожоба — смягчающе средство и кондиционирующая добавка для кожи, сделанные из масла жожоба и воска.
TOCOPHEROL — Витамин Е, мощнейший антиоксидант, а значит этот витамин эффективно защищает кожу от старения и повреждающих факторов окружающей среды.
CAPRYLYL GLYCOL — Эмолент.
PHENOXYETHANOL — Консервант.
MAY CONTAIN / PEUTCONTENIR (+/-): MICA, TITANIUM DIOXIDE (CI 77891), IRON OXIDES (CI 77491, 77492, 77499) — Красители.

Как и какво да затвори стави гипсокартон

Точно оразмеряване на фуги и тяхното пълно изсъхване на всеки етап — ключът към гладка повърхност без пукнатини за години напред. В тази статия, и насочи как последователно и правилно запечатване на фуги на сухото строителство и печата на ставите на сухото строителство, което е по-добре да се вземе на шпакловка и лентата.

Гипсокартон — модерен материал, който набира популярност се дължи на сравнително проста технология монтаж, ниски цени и широк обхват на приложение. Можете да монтирате и вътрешни стени на листовете с различни дебелини на сухото строителство, както и на няколко нива тавани, както и различни декоративни елементи (ниши, пиластри).

Изпълнете мазилка върху крайния повърхността на сухото строителство е също така, по принцип, не е лесно, особено с инсталация за качество. Но много често с течение на времето, на мястото на гипсокартон ставите пукнатини, тя е много разваля външния вид на готови повърхности, по-специално тавани. Най-често това се дължи на дизайна на цялостното свиване, които са най-податливи на нови сгради. Изчакайте няколко години, общото свиване дома могат да си позволят не всички; Освен това, няма гаранция, че пукнатините в структурите на GCR се появяват по-късно. Какво да направя, за да не се налага редовно да възстанови повърхността?

Вие ще трябва:

Етап 1 сухото строителство съвместни съединение: скосяване на листове с

Първо трябва да бъдат скосени по шевовете. За това отговарят на нормалното ножа писане, но това е по-добре да изберете по-траен вариант, подсилена с метални пътеки — пластмаса може бързо да се съборят. Фаската оттеглена nezavodskih изключване стави на 45 градуса спрямо повърхността. С шевовете фабричните не трябва да бъдат отстранени фаска.

Етап 2: праймер листове и ставите

Преди да започнете Шпакловъчни, повърхностни маслени бои трябва да бъдат добре грундирани. обръща специално внимание на шевовете — те се обработват грунд с четка.

Етап 3: шпакловка фуги

Важно е, отколкото да се запечатат фугите между гипсокартона. Важно е да се избере гипсова шпакловка! След зареждане шевовете плътно запушен с гипсова мазилка. Гипс здраво и сигурно свързване на плочите, и също ще спести на деформация при смяна на влажност и температурни промени.

  • По-добре е да не се мързеливи и да споделят шпакловане на фуги на два етапа: първо, за да вкара шев със смес от дълбоко, изчакайте за сушене на материала и да премине същите стави за втори път, като ги сравнява с повърхността.

Най-добре запечатани шевове на този етап, толкова по-силно ще се съхраняват залепени впоследствие на подсилваща лента. Преди лента етикет шевовете са опесъчени голяма шкурка.

Етап 4: усилващи шевове

Последващите усилващи шевове може да се направи по два начина, в зависимост от това какъв вид лента за запечатване на фуги на сухото строителство.

  • Първият, най-лесно и бързо — използването на самозалепващи serpyanku. По принцип е добре спасява от пукнатини и надпишете това отнема доста време, но, както показва практиката, от друга, отнемат повече време, методът все още е надежден.
  • Тази хартиена лента стикер на лепилото от корнер PVA. Лепило с четка гъсто намазана шев лента се залепва и пресова в движение смазва шпатула. Излишната лепило под лентата не трябва да остане. Непосредствена близост тавана и стените също се нуждаят от лепило, ако не са включени единица цокъл; Хартиена лента е лесно да се наведе наполовина по указания ред.

Етап 5: Заключителни шевове палто

За да се запечата правилно ставите на сухото строителство, след пълното изсъхване на лентата (по-добре издържат на ден) шевове отново shpaklyuyut мазилка смес. По това време, основната цел — да изравни връзката с главното равнина, особено в краищата им по подразбиране, които са по-добре proshpaklevat два пъти и довършителни пред проверка Шпакловъчни дали остава на повърхността на ями или напротив, могилите. За да се избегнат последните шевовете по-добре отново да се смила голяма кърпа.

Още по-интересни статии

Свързани статии

Дефекти на мазилката и елиминирането им

Ремонт на апартаменти

Дефекти на мазилките и тяхното отстраняване

13 април 2012 г. |

След един — два дни открихте, че има дефекти върху измазаната повърхност. Те биха могли да възникнат, преди всичко, поради несъответствие с технологията на мазилката или поради неправилната подготовка на гипсовите разтвори.

Основните дефекти на мазилката са:

Пукнатини. които възникват в мазилката обикновено се използва нестандартни разтвори: или с високо съдържание на свързващи вещества, или слабо смесени, се натрупва места, където твърде много пълнители или свързващи вещества.

Също така, пукнатини се формират от погрешно ускорено изсушаване на мазилката: поради високата температура в стаята, наличието на течение.

Причината за образуване на пукнатини може да бъде нарушение на технологията наслояване разтвор: праймер прилага невтвърден obryzg или преждевременно, когато се прилагат редуващи се слоеве на многослойна земята (когато дебелина контур), или когато финишно покритие се прилага към зреене праймер. Пукнатини неизбежно ще настъпят и при мазилка със слой с дебелина повече от 30 / lm без подсилваща рамка.

Пукнатини в мазилката под клетките на пълненото дроно са възможни от използването на лошо качество (дебела нарязана) драна или от недостатъчната дебелина на хоросана над тренировката.

За да избегнете такъв дефект като пукнатини, при подготовката на решение трябва строго да наблюдавате пропорциите на добавените компоненти, както и добре да смесвате мазилката. Приложеният слой мазилка трябва да бъде защитен от твърде висока температура, вятър, течение и следователно за времето на сушене, трябва да затворите вратите и прозорците в стаята.

За елиминиране на пукнатини е необходимо тяхното внимателно рязане, измиване с вода и плътно запълване със същото решение, от което е направена основната мазилка, следвано от внимателно изстъргване. Ако голям брой пукнатини изискват непрекъснато шлайфане на мазилката с внимателно разширение на всяка пукнатина.

Мехури (ватиран) — бучки подуване на повърхността на мазилка образуван чрез прилагане на разтвор, получен вар към зелено. Малките частици продължават nezagasivsheysya вар погасява в мазилка, доколкото охлаждащата еднократно вар се увеличава рязко до степен, че има оток и разрушаването на мазилка слой под формата на отделни точки. Когато малки количества от подуване се отстранява от повърхността на мазилката otrezovki остър край (избирам), навлажнен с вода, разтворът се прилага към нормалното и изглаждане надолу наравно с повърхността на мазилката. В случай на значителни повреди от набъбване (денички), мазилката трябва да бъде нарязана и измазана отново

разтвор на стари вар.


Разширената мазилка трябва да бъде напълно отстранена, повърхността и мазилката отново да се изсушат.

Пилингът се образува, ако разтворът се нанася върху много суха повърхност или върху изсушен разтвор. Също така, разслояване настъпва, когато последващо слой е по-мощен от предишния (например вар цимент слой прилага) — при прилагането на различни решения (например, когато се прилага за варовиков цимент разтвор). Изцедената мазилка трябва да бъде заменена с нова.

Пукнатини в обвивката. Възникват, ако ъглите на стените или фугите на повърхности от различни материали са зле подготвени за обработка, а също и ако се извършват мазилки върху суха дървена повърхност. В допълнение, такъв дефект се проявява в крехкото привързване на структурите, които ще бъдат лекувани. Тези пукнатини не възникват, ъглите и ставите на различни повърхности, преди прилагането на решение да се затваря решетка, а пресушените дървени тавани и стени се овлажняват с вода.

Недостатъчна якост. Дефектът възниква, ако няма достатъчно количество стягащо средство в разтвора или в случай на силно замърсяване с пясък. Дефектът се определя чрез подслушване. Когато се установи ниска якост, дефектната мазилка се отстранява и се заменя с по-трайно решение.

Препоръчваме правила за избягване на дефекти в мазилката:

При мазилки от тухлени стени повърхността трябва да бъде предварително навлажнена, при условие че температурата на околната среда е равна или по-голяма от 23 ° С.

За да извършите мазилката на високо ниво, трябва да използвате маяци, чиято дебелина трябва да съответства на дебелината на мазилното покритие, без да се взема предвид покриващия слой.

При нанасяне на покритието в един слой, повърхността трябва да бъде изравнена веднага след нанасянето на разтвора. Ако се използва мистрия, подравняването трябва да се извърши веднага след поставянето на хоросана.

При нанасяне на покритие на няколко слоя, всеки последователен слой се нанася, след като предишният е захванат, а покриващият слой се полага само след поставяне на разтвора. Преди хаванът да се прилепи към повърхността, е необходимо да се изравнят почвата.

Монтирането на гипсови продукти трябва да се извърши след нанасяне на разтвора за гипс и пълно изсушаване на основата. Всички архитектурни детайли на фасадата са прикрепени към армировката, която е заградена в стените и е защитена от корозия.

Допустимата дебелина на един слой гипс от гипсов състав не трябва да надвишава 15 мм, от всички други състави — 20 мм. При монтиране на многослойни мазилки дебелината на слоя върху каменна, тухлена и бетонова повърхност не трябва да надвишава 5 мм, върху дървена — 9 мм, на циментова настилка — до 5 мм.

Споделяне в социалните мрежи:

сроден

  • Каква е разликата между мазилка и шпакловка, как да се разбере мирянин
  • Ремонт на повредени стени от гипс
  • Стена в гипс дрехи
  • Мазилка на стени Част 3 Технология на мазилки
  • Текстурирана мазилка в интериора
  • Работи по мазилка, стени, фасади
  • Пукнатини в мазилката
  • Разходите за мазилка фасада работи или колко е мазилката на фасадата
  • Ремонт на стени преди боядисване строителна работилница
  • Основи на ремонт на мазилка на вътрешните стени и екстериор как да се укрепи финала, отколкото да…
  • Мазилка от цокли
  • Стъпка стени със собствените си ръце
  • Мазилка за ветронит, мазилка за гипс
  • Пукнатини по стените след ремонт как да се премахнат
  • Как да направите мазилка хоросан
  • Как да измаза тухлената стена с технологията на нанасяне на материала
  • Изцеждане на гипс
  • Редът на мазилките работи — мазилки
  • Мазилки работи в Voronezh, мазилки стени
  • Декорация на мазилки за вътрешни стени мазилка, строителство, ремонт, декорация, довършителни…
  • Състав на мазилни работи — шпакловки

ТОРО СТРУКТУРИТНЫЙ ПРАЙМЕР — PCI-Augsburg GmbH

THORO STRUCTURITE PRIMER Однокомпонентная укрепляющая грунтовка Описание продукта THORO STRUCTURITE < strong>PRIMER представляет собой смесь портландцемента, тонкодисперсного наполнителя и редиспергируемого полимера в виде порошка. Смешанный с водой, THORO STRUCTURITE PRIMER образует кашицу для нанесения кистью на очищенную арматуру.При отверждении образует светло-серое покрытие. Применение В качестве антикоррозионной грунтовки стальной арматуры перед ремонтом бетона. THORO STRUCTURITE PRIMER рекомендуется использовать там, где армирование находится в пределах 10 мм от поверхности отделки или где присутствуют хлориды. Преимущества Эффективность — Отличные антикоррозионные свойства. — Хлорид/водостойкий. — Никаких потерь. Простота в использовании — Один компонент, который нужно смешивать только с водой.- Отвердевает во влажных закрытых помещениях. Экологически чистый — не содержит растворителей. Цвета Светло-серый. PE_THORO STRUCTURITE PRIMER.doc – 30/10/12 1/2 Покрытие прибл. 1,5 кг/м² порошка на слой прибл. 1 мм. ± 0,1 кг порошка на метр арматуры (12 мм) на слой. Упаковка Банка 5 кг. Хранение Все материалы должны храниться под навесом и вдали от земли. Беречь от всех источников влаги и мороза. Меняйте запасы, чтобы срок годности не превышал 24 месяца.Нанесение Подготовка основания Все побочные продукты коррозии должны быть удалены (заготовка из стали) по всей окружности на 360° стальной арматуры, подлежащей покрытию. Подготовка должна соответствовать стандартам ISO 8501-1 / 12944-4, степень очистки Sa ​​2. Замешивание Жизнеспособность 60 минут Плотность во влажном состоянии 1,95 кг/дм³ Жидкость для смешивания ± 0,24 л чистой воды/кг порошка Каждый килограмм <сильного >THORO STRUCTURITE PRIMER потребуется приложение.0,24 литра чистой воды. НЕ добавляйте никакую другую жидкость или порошок. Постепенно смешайте порошок с водой лопаткой или лопаткой, пока не получите тестообразную консистенцию без комков.

Ремонт и модернизация, услуги по модернизации — Associated Polymers, Мумбаи

Ремонт и модернизация, услуги по модернизации — Associated Polymers, Мумбаи | ID: 2457070562

Описание продукта

  • STRUCTURITE PRIMER : наносится на поверхность, защита арматуры от ржавчины смола для живых трещин
  • CONCRESIVE 2200i: тиксотропный выравнивающий раствор на основе эпоксидной смолы и шпатлевка (0. толщиной 5–3 мм)
  • CONCRESIVE ERL : тиксотропный облицовочный раствор на основе эпоксидной смолы с подкладкой (3 мм + толщина)
  • CONCRESIVE 1020 : грунтовка на основе эпоксидной смолы без растворителя для CONCRESIVE ERL
  • CONCRESIVE 1418T : тиксотропная обтекающая основа на основе полиэфирной смолы
  • CONCRESIVE 1414: связующее вещество на основе эпоксидной смолы для бетона и строительных растворов с длительным открытым временем
  • EMACO BONDING AGENT: акриловое связующее вещество с отвердителем
  • вяжущий раствор
  • RHEOMIX 141 : Полимеры SBR для производства полимерного раствора и цементного раствора для склеивания
  • EMACO S48C T : Точно изготовленный цементный раствор для ремонта бетона в строительных конструкциях.

Заинтересованы в этой услуге?Уточнить цену у продавца

Связаться с продавцом


О компании

Год основания1998

Характер деятельностиПроизводитель, дистрибьютор

Член IndiaMART с апреля 2011 г.

Компания

Associated Polymers была основана г-номB.D.Sawant в 1998 году для удовлетворения потребностей композитной промышленности. Raj Pigment Products является дочерним предприятием Associated Polymers, основанным в 1995 году, и является пионером в производстве органических и неорганических типов эпоксидных и полиэфирных пигментов, необходимых для производства композитов. Компания Raj Pigment Products готова разрабатывать и поставлять пигменты, необходимые для композитной промышленности и в соответствии с потребностями клиентов. Ваша потребность в цвете — наша забота. Головной офис Associated Polymers расположен в деловой столице Индии, г.е. Мумбаи. Хорошо налаженная сеть продаж Associated Polymer обеспечивает быстрое и качественное обслуживание клиентов по всей стране. У нас есть команда техно-коммерческих продаж и маркетинга, которая удовлетворяет все потребности наших клиентов под одной крышей. Качество во всех аспектах, т. Е. Продукт и обслуживание, стало вехой нашего успеха. Мы с нетерпением ждем возможности удовлетворить ваши потребности во всем.

Вернуться к началу

1

Есть потребность?
Лучшая цена

1

Есть потребность?
Лучшая цена

Грунтовка Thoro Structurite p.8 Thoro Structurite 100 стр. 8 Thoro Structurite R4 с. 8 Thoro Structurite FR с.

9 Уровень Thoro Structurite с.

1 Водосточная система THORO WATERDICHTING Гидрозаглушка с. 4 Тороуплотнение с. 4 Thoroseal FC с. 5 Thoroseal WR с. 5 Торосил FX100 с. 6 Thoroseal FX 1K с.6 BETONHERSTELLING BESCHERMING HERSTELLING HERSTELLING VAN VLOEREN EN WEGDEKKEN VOEGAFDICHTING AANGIETEN & VERANKEREN TOESLAGSTOF VARIA Thoro Structurite Primer с. 8 Thoro Structurite 100 стр. 8 Thoro Structurite R4 с. 8 Thoro Structurite FR с. 9 Уровень Thoro Structurite с. 9 ДЕКОРАТИВНЫЕ ПОКРЫТИЯ BESCHERMENDE Thoro Primer 1000 стр. 11 Торо Шин с. 11 Thoro Lastic S (гладкая) с. 11 Thoro Glaze SG (полуглянцевая) с. 11 HYDROFOBEERMIDDELEN Thoro Enviroseal B с. 12 Thoro Enviroseal 20 стр. 12 ПОКРЫТИЯ BESCHERMENDE CEMENTGEBONDEN Thorotect CR с.13 Thoro Quickseal с. 13 Thoro Roadpatch с. 14 Торо Крит HS с. 14 Этаж Торо с. 14 Выравниватель люков Thoro с. 15 Thoro Rapid Primer с. 15 Торо Крит SL с. 15 Водяной пакет Thoro с. 16 Захват Торо с. 17 Thoro Grout GP с. 17 Торо Акрил 60 стр. 18 Торо Бонд с. 18 Торо Борстель с. 5 Трехтерпистолет с. 5 ТОРО водные дихтинг с. 1

2 PE EC THORO водосточная система вашего здания. ou ur fo oc cu нас. п. 2 t f

3 Over Thoro В 1912 году инженер-боувкундиг Эдвард Х.Canon er geen idee van dat zijn THORO producten een belangrijke bijdrage zouden levelen bij de vorming van de belangrijkste productent van gespecialiseerde bouwmaterialen. Zijn bedrijf, Standard Dry Wall Crafts, имел двойную работу: перед ней стояли проблемы в промышленном производстве и производились качественные продукты. Стандартные ремесла Dry Wall Crafts эволюционировали в продуктах Thoro System, которые были проверены и проверены в течение длительного времени. Meer dan 100 jaar ervaring in waterdichting en betonreparatie heeft THORO de juiste knowhow en ervaring om steeds een gepaste oplossing an te bieden, ongeach het probleem. De kwaliteit en de waarde van de THORO producten wordt wereldwijd erkend en zij worden vervaardigd volgens de strengste normalen. Het doel van THORO является дверью de jaren heen echter niet veranderd: he wereldwijd aanbieden van innovatieve en doeltreffende oplossingen in de bouwinddustrie. De THORO producten zijn Universeel erkend door international gerespecteerde keuringsorganismen в землях Дюйтсленда, Het Verenigd Koninkrijk, België, Spanje, Frankrijk, Noorwegen, Finland, Italië, de VSA en andere.Продукция компании THORO в Хаме, Бельгия, сертифицирована в соответствии с EN ISO 9001 и EN ISO THORO waterdichting p. 3

4 Waterdichting Waterplug Snelzettende цементный раствор для установки на миддельллийк афдихтен ван активный водоток в метсельверке в бетоне. Stop onmiddellijk infiltraties en insijpeling van water, zelfs onder druk, doorheen barten, voegen en gaten in beton of metselwerk. ) THO05BI001 шина 1 кг 12 THO05BI002 шина 5 кг 75 THO05BI003 шина 25 кг 22 Thoroseal grijs 250 мл воды на кг poeder Cementgebaseerde waterdichte Coating voor beton en metselwerk. СЕ. Voor binnen en buiten, bovengronds en ondergronds Vervangt waterdichte pleister Als waterdichting van vochtige ruimtes alvorens decoratief af te werken 2 van 1 mm dikte goegekeurd voor contact met drinkwater Toepassing: kelders, vijvers, zwembaden, водоемы, regenputten, тоннели,… 25 кг 48 гр THO05BL050 автобус 25 кг 24 гр THO05BL003 зак 25 кг 48 т THO05BL051 автобус 25 кг 24 т 5,2 л: 3,9 л. вода + 1,3 л. Акриловый шпатель 2 кг/дм³ 1-2 мин 2-3 мин 1 мм 2 Thoro borstel trechterpistool 2 кг/мм/м² THORO промывка водой 45 мин 300 мин с.4 t f

5 Waterdichting Thoroseal FC (Foundation Coating) Цементное базовое водорастворимое покрытие для бетона и бетона. СЕ. Voor binnen en buiten, bovengronds en ondergronds Vervangt waterdichte pleister waar geen decoratieve vereisten zijn Als waterdichting van vochtige ruimtes alvorens decoratief af te werken 2 van 1mm dikte Toepassing: kelders, vijvers, zwembaden, waterreservoirs, 2k0BL, туннели… 48 кг Thoroseal WR 5,3 л: 3925 л.вода + 1325 л. Acryl 60 Waterdichte Cementpleister — цементирование бетона и метсельверка. СЕ. Géén праймеры toeslagstoffen nodig. Voor bakstenen betonnen ondergronden. Voor binnen en buiten, bovengronds en ondergronds Sulfaatbestendig (grijze versie) — zeer goed geschikt voor bakstenen ondergrond Waterdicht vanaf 10mm dikte — dikte tot 15mm per Zeer soepele en snelle verwerking, handmatig met wormpomp Toepassing: kelders, lift, zwembaden, badcheskamers , водохранилища, regenputten,… THO05BO007 зак 25 кг 48 гр THO05BO008 зак 25 кг 48 с 3,6 л. вода 1 мм мм 1 plakspaan открытая червячная помпа +/- 2 кг / 20 кг/ см/м² 60 мин 180 мин Thoro borstel — trechterpistool > 30 мин +/- 165 мин Thoro borstel Speciale kaleiborstel voor de correcte van Thoro waterdichtingscoatings en beschermende Coatings en Cepro kaleimortels . 15 см порода. искусство. № verpakking omverpakking THO72FW001 Stuk 12 Hopper Gun Трехтерпистолет для универсального использования. Thoroseal, Thoroseal FC, Thoroseal FX100 — FX110, исполнение Stacepro Snelle Zeer hoog. Aan te sluiten op (kleine) компрессор. искусство. nr verpakking omverpakking PRL70FP003 stuk 1 THORO waterdichting p. 5

6 Waterdichting Thoroseal FX100 Flexibele цементное базовое покрытие для заливки водой и бетонированием бетоном и метсельверком. 2 компонента: poeder en vloeistof. CE gekeurd voor bescherming van beton. Для binnen en buiten, bovengronds en ondergronds Blijvend flexibel, geschikt voorstructuren die onderhevig zijn aan beweging Goedgekeurd voor contact with drinkbaar water Sheuroverbruggend tot 0,5mm of tot 1,2mm indien met FX mesh versterkt Goede chemische resistentie tegen: zacht water, Afvalwater, Gier EN Adere Vloeistoffen Die Middelmatig Agressivef Zijn Voor Minerale Ondergroden 2 van 1mm Toepassing: Waterdichting: Terrassen, Badkamers, Zwembaden, Natte Ruimtes Voor Het Aanbrengen Van Tegels Tevens Zeer Geschikt Bej Balkonrenvaties ALS Waterdichte Beschermende покрытие Alvorens EEN Betegeling TE Plaatsen ex tegellijm Betonbescherming tegen carbonatatie, water en dooizouten Thoroseal FX1K 10m² в наборе Eéncomponent flex exibele цементное покрытие для покрытия водой, растворенной в бетоне в бетоне и метсельверке. Aangemaakt встретил воду vormt heeen elastische waterdichte en beschermende afwerk voor beton en metselwerk. Для биннэн en buiten, bovengronds en ondergronds Blijvend flexibel, geschikt voorstructuren die onderhevig zijn aan beweging Uitgehard laat een 2 mm dikke THOROSEAL FX 1K покрытие и кромка пальца до 2 мм. Toepassing: Waterdichting: terrassen, badkamers, zwembaden, natte ruimtes voor het aanbrengen van tegels Tevens zeer geschikt bij balkonrenovaties als waterdichte beschermende покрытие alvorens een betegeling te plaatsen met een flex tegellijm Betonbescherming tegen carbonatatie, water en dooizoutouties, Советы Analyseer het probleem grondig Dicht eerst alle activee lekken af, alvorens de waterdichting aan te brengen Nooit op geschilderde ondergronden werken Steeds op een ruwe ondergrond werken.Bij gestorte kelders: let op voor te gladde wanden en ontkistingsolie Respecteer de mengvoorsschriften en voorsschriften Werk met de juiste gereedschappen Raadpleeg steeds de technische fi che THO05BL030 zak 15 kg 48 grijs 5,6-6,2 l. вода 1 мм 2 Thoro borstel trechterpistool 9 м² в комплекте THO05BL011 THO05BL013 зак 25 кг зак 25 кг гриль с 10 л. Часть 2 Жидкость 10 л. Часть 2 Жидкость 1мм 1мм 2 2 Thoro borstel trechterpistool THO05BL015 автобус 10 л. 48 Часть 2 Жидкость +/- 45 мин с. 6 t f

7 Productkeuzegids In onderstaande tabel vindt u makkelijk terug welke producten u kunt gebruiken voor uw specifi eke toepassing.Producten Waterdruk Maiaveld Positief Negatief Bevengronds Ondergronds acteve lekken Sulfaten Bewegende Scheuren Oppervlakte Uitgebreid Lokaal Thoro Waterplug Thoroseal Throseal FX Thoroseal Wr Throseal FX 1K Throseal FX 100 Thoro Waterpack Kelderdichting: Stap Voor STAP Raadpleeg Стидс де Техрища Форгольника. 1.Kap de kimnaad открыт. Де kimnaad является де ananluiting tussen де muur en de funderingsvoet de betonplaat waar de waterinfiltratie zich heerst manifesteert.Kap de kimnaad open (2 см бриджа и 2 см диеп, niet V-vormig). 2. Водяная пробка. Гидравлическая заглушка встроена в бетонный раствор в бетоне и метсельверке на мидделлийк дихт. Omwille van zijn snelle moet Waterplug steeds in kleine hoeveelheden aangemaakt worden. U maakt лучший gebruik van een Rubberen kuipje waarin men een beetje poeder mengt met drinkbaar water (koud water vertraagt ​​de — теплая вода versnelt de). 3. Vul de Kimnaad op. Рейниг де Кимнад встретился с водой. Zorg dat er geen vrijstaand вода aanwezig есть.Vul nu op met de aangemaakte Waterplug en work af onder 45 met de vloer. 4. Muurdoorvoeringen en bevestigingen Verrankeringen en bevestigingen zijn gemakkelijk uit te voeren met Waterplug. Voor muurdoorvoeringen (waterleidingen, ) умирают на grondwaterniveau kunnen komen, gebruikt u Thoro Waterpack. 5. Бевохтиг де ондергронд. De ondergrond moet vooraf goed bevochtigd worden. Een sterk zuigende ondergrond meermaals bevochtigen. Zorg dat er geen vrijstaand вода aanwezig есть. 6. Тороселирование.Thoroseal (WR) представляет собой гидроизоляционное покрытие (пленку) на цементной основе из бетона в метсельверке. Thoroseal wordt смешивается с питьевой водой (+/- 5,7 л. на фургон verpakking 25 кг.). С помощью Thoroseal можно сделать более эффективную смесь (5,2 л на 25 кг) и лучше всего использовать Thoro Acryl 60 (1,3 л) и 3 доли воды (3,9 л). Thoroseal WR wordt aangemaakt соответствует +/- 3,6 литра питьевой воды. 7. Правильный менген. Meng bij voorkeur mechanisch. Kleine hoeveelheden kunt u ook handmatig mengen.Voeg het poeder geleidelijk toe en meng met een mechanische Mixer op toerental (t/min.) tot een samenhangende en klontervrije massa. Юридическая консистенция ван het mengsel является zeer belangrijk. Voor Thoroseal — это deze bereikt wanneer een Thoro-borstel in schuine toestand net niet omvalt. 8. Анбренген. Breng de gemengde Thoroseal op een goed bevochtigde ondergrond aan met een Thoro-borstel. Het продукт пошел в de ondergrond borstelen. Торцевое уплотнение имеет угловое сечение с шагом +/- 1 мм. Zorg voor een goede ananluiting фургон +/- 20 см.встретил де vloerplaat. Beng de tweede de volgende dag aan op dezelfde manier als de erste (дикте +/- 1 мм. ). Om een ​​goede dekking te controleren kunnen de in twee verschillende kleuren worden uitgevoerd. Thoroseal WR: schraap + nat-in-nat op een dikte van 1 to 1,5cm aanbrengen. In een koude of ongeventileerde omgeving kan een langere uithardingsperiode nodig zijn. Вермейд конденсатная дверь экстра тэ ventileren. Gebruik nooit luchtontvochtigers gedurende de eerste 28 dagen na het aanbrengen. De eerste weken на хет aanbrengen кан конденсации optreden.Это волкомэн нормаал. 9 Afwerking Thoroseal (WR) представляет собой сверхтонкое покрытие с добавлением цементной основы (met een zeer grote waterdampdoorlaatbaarheid) и зоалов Thoro Quickseal. Wacht hiervoor minstens 3 dagen, tot de Thoroseal volledig uitgehard is. Dampdichte materialen zoals olieverven, винил, vele soorten behangpapier, zijn absoluut te vermijden. Вы можете использовать декоративную гладь, созданную с помощью Thoroseal WR gebruikt worden. ТОРО водные дихтинг с. 7

8 Betonherstelling Thoro Structurite Primer Однокомпонентная грунтовка для вапенингов. Aangewezen bij geringe betondekking na herstelling of bij aanwezigheid van clonen Bevat ingebouwde corrosie-inhibitor Uitstekende roestwerende eigenschappen Voldoet aan EN (европейская норма для праймеров) Подъезд: надлежащее wapeningsstaven — 2 фургона 1 мм с мин. 1 кг 0 мин. Структурит Р4 0,24 л. воды на кг состава Thoro Structurite 100 Eencomponent crimpcompenserende цементаgebaseerde vezelversterkte reparatiemortel voorstructurele betonherstelling.Для структурного бетонирования ван балкенов, коломменов и бетонных структур Bijzonder geschikt voor zowel kleine als Grote Reparaties Tixotrope Zeer goede Makkelijke Verspuitbaar with wormpomp with open trechter Voldoet aan class R4 volgens EN Toepassing: herstelling van gewapend en ongewapend beton, dikte 5-0za 25 кг 48 гр 3,8 л воды (ручная) 4,2 л воды (душ) Eencomponent snelzettende цементная основа vezelversterkte reparatiemortel voor Structurele betonherstelling mm 2 borstel 0,1 кг на погонный метр 1,8 кг/дм³ 60 мин 2u 60 мин 240 мин Toro Waterdichting Vezelversterkt en polymerverbeterd Ingebouwde orifierbeterd engibouwde origig-ингибитор 3,25 л. вода 5-50 мм трувель 1,9 кг/дм³ трувель, открытая червячная помпа мин. 30 мин с. 8 t f

9 Betonherstelling Thoro Structurite FR Целесообразное цементное уплотнение цементного основания для ремонтных работ. Важная информация: открытый бэкистинг, gietbaar en verpompbaar Gebruik van trilnaalden overbodig Voldoet aan classe R4 volgens EN Toepassing: balkonranden, kolommen, vloerplaten,… THO05BF030 zak 25 kg 48 grijs 2,9 l. вода (vloeibaar) 2,35 л. вода (пластик) Thoro Structurite Level Eencomponent egalisatie-en reparatiemortel, цементная основа, полимерная смесь.Uitstekende Voldoet aan class R2 volgens EN Toepassing: op betonnen elementen en betonwanden: uitvlakken, egaliseren, herprofi leren, dunne afwerk dichtsmerengrindnesten THO05BF028 zak 25 kg 48 betongrijs 3,75 l. вода 5-50 мм > 50 мм: 25% измельчение до 2-10 мм 1 струя червячной помпы plakspaan trechterpistool червячная помпа 2 кг/дм³ >30 мин. . 9

10 Betonherstelling Productkeuzegids Producten Producteurezegids Producten Tyshische Contactuentie Wapeningsbescherming Verticaal / Bofen Het Hoodd Horizontaal Tixotroop Vloeibaar Weorseand The Ghero Structuritate Primer Toro Structurite 100 Thoro Structurite R4 Thoro Structurite FR NVT Toro Structurite уровень NVT NVT Thor Crete HS NVT NVT SL nvt nvt Producten Uitharding Sterktes 20 C druksterkte na 2u druksterkte na 1 dag druksterkte na 28 dagen nvt: niet van toepassing hechtsterkte Thoro Structurite мин. 16 Н/мм² 50 Н/мм² P 2,5 Н/мм² Thoro Structurite R4 20 мин 11 Н/мм мм² 45 Н/мм² P 2,3 Н/мм² Торо Structurite FR 30 мин 25 Н/мм² 55 Н/мм² P 3,5 Н/мм² Торо Structurite Level 45 мин 10 Н/мм² 35 Н/мм² P 0,8 Н/мм² Торо Crete HS 20 мин 15 Н/мм² 30 Н/мм² 55 Н/мм² P 2,4 Н/мм² Thoro Crete SL 20 мин 10 Н/мм² 35 Н/мм² P 2,0 Н/мм² Thoro Structurite R4 alle weergeven waarden zijn typische waarden , géén Minimum waarden Tho ro Crete SL THORO Waterdichting Thoro Structurite Level Thoro Crete SL Thoro Structurite грунтовка Thoro Structurite 100 Thoro Structurite FR Thoro Crete HS с.10 t f

11 Bescherming Декоративные покрытия Beschermende Thoro Primer 1000 Stabiliserende грунтовка. Верхний слой грунта Vermindert de poreusheid Gunstige, включенный в состав оборудования, предназначенного для ремонта. Подъем: минеральное покрытие, нанесенное сверху, с ThoroLastic — ThoroSheen THO04AT002 bus 20 l gebruiksklaar Thoro Sheen Starre beschermende and decoratieve Coating for beton en metselwerk. Гладкое, двойное и нестандартное покрытие Цвет: RAL, NCS и британский стандарт, краска для бака, влажная дверь, латентная основа из акрилата Подошва: бетон, метсельверк и цемент, цвет: RAL, NCS, британский стандарт THO04AM004 emmer 15 л. 24 вит и пастель THO04AM005 emmer 15 л. 24 средний THO04AM006 эммер 15 л. 24 глубины Thoro Lastic S gebruiksklaar мин. 150 мкм шероховатое сверхчистое, гладкое декоративное покрытие из бетона и метсельверка с нулевым содержанием CO 2 — / углеродное покрытие собственного производства. Шейровербюгенд дот 0,3 мм, влажная дверца, латентная гладкая вода, очищающая масляную краску, прозрачная, сухая и УФ, на основе ванильного акрилата 2 дроогтиджд борстэл, лагедрахпуит 0,05-0,2 л/м² мин. 4 дня 20 C и 70% RV дроогтийд борщ ролл безвоздушный 0,3-0,6 л./м² мин. 4u bij 20 C en 70% RV tussen de 2 Подводка: бетон, метсельверк и цементный слой Цвет: RAL, NCS, Британский стандарт THO04AM010 Emmer 15 л. 24 вит и пастель THO04AM011 emmer 15 л. 24 средний THO04AM012 эммер 15 л. 24 глубокого Thoro Глазурь С.Г. gebruiksklaar Transparante zacht-glanzende покрытия пакета де bescherming ван бетоновозные ан metselwerk Eéncomponent acrylaatgebaseerde покрытие Vermindert uitbloeiingen, algengroei ан vervuiling, является reinigbaar Dampdoorlatend, uitstekende СО 2 bescherming Verbetert гет uitzicht ван gewassen бетона (silexbeton) Применение: бетон, metselwerk , gewassen beton — nieuw beton en metselwerk minstens 28 dagen laten uitharden — niet geschikt voor cellenbeton, leisteen, keramiek en horizontale toepassingen THO02AF004 автобус 20 л. 24 wt прозрачный na droging gebruiksklaar min µm 2 droogtijd borstel rol безвоздушный 0,5-0,7 л./м² мин. 4u bij 20 C en 70% RV tussen de 2 droogtijd rol borstel lagedrukspuit 0,1-0,4 л./ m² min 1u bij 20 C en 70% RV THORO waterdichting p. 11

12 Bescherming Hydrofobeermiddelen Thoro Enviroseal Б Watergedragen hydrofobeermiddel пакета де bescherming ван Baksteen Actieve stoffen: silaan / siloxaan Onzichtbaar на droging Gebruiksklaar, garandeert ееп констант Kwaliteit оп де Верфа Solventvrij, milieuvriendelijk Применение: metselwerk Uit Baksteen, kalkzandsteen ан ZAND-cementpleisters THO02AG001 автобус 5 литров 96 THO02AG002 автобус 20 литров 24 вит, kleurloos na droging Thoro Enviroseal 20 Watergedragen алкилалкокси силан гидрофобизатор для смешивания бетона Активные вещества: силанен — ​​волдоет и CE dooi cycli en vertraagt ​​vervuiling Solventvrij, milieuvriendelijk Подъезд: горизонтальный и вертикальный бетон: gebouwen, bruggen, autowegen, betonconstructies, stadions, koeltorens и andere betonstructuren THO02AG004 автобус 20 литров 24 wit, kleurloos na droging gebruiksklaar 1 lagedruks ksklaar 1 lagedrukspuit 0,25-1 л/м² 0,1-0,3 л/м² THORO Waterdichting p. 12 tf

13 Bescherming Beschermende цементные покрытия Thorotect CR Chloride- en carbonatatieremmende, vries-dooibestendige покрытие на цементной основе Sterk carbonatatieremmend Realkaliseert gecarbonateerd beton Hoogwaardige bescherming tegen chlorin, dooizouten, water en vries-dooi cycli Toepassing: brug, , in kust- en industriegebieden Kleur: Verpakking: wit, grijs wit — zak 25 kg — art. THO04AU005 — поддон 48 ст грейс — зак 25 кг — арт.THO04AU004 — поддон 48 ст THO04AU003 THO04AU005 зак 25 кг 48 гр Thoro Quickseal 5,0 л. Acryl 60 (4,6-5,4) Цементная основа для бетона и метсельверка Для биннэна и смеси Гладка строительного бетона Harde en duurzame afwerking Гладка афверк для (цементерде цвембаден) Подошва: бетон, метсельверк и zand-cementpleisters, zwembaden THO 04 48 вит 2,1 л. Акрил, 3 л. вода 1 мм 2 2 борщ ролл 3,4 кг 45 мин 410 мин 0,5 кг на борщ 300 мин 300 мин THORO waterdichting p.13

14 Herstelling Van Betonnen Vloeren En Wegdekken Thoro Roadpatch Snelzettende ReparatiemortiemorteMortel Voor Betonnen Wegdekken Klasse R4 Volgens En Snelle Mortell Voor Kleine Herstellingen (Макс +/- 0,5 м²) встретил Глазвезель Вертеркт Зевер TierdbeSparend, стерке, Beperking van voor herkeer na 1 uur Toepassing: wegen, brugdekken, industrievloeren THO05DB001 zak 25 kg 48 grijs 3,6 l. вода Thoro Крит HS Snelzettende reparatiemortel пакет betonnen wegdekken Klasse R4 volgens EN Snelle polymeerverbeterde Mortel пакет: бетон onderhevig ан verkeersbelastin Вуры Kleine ан Grote reparaties Eenvoudige ан snelle verwerking Na slechts enkele Uren opnieuw belastbaar Применение: Wegen, brugdekken, промышленный ан magazijnvloeren, startbanen ан platformen THO05DB007 зак 25 кг 48 гр 3,0 л.вода мм мм truweel plakspaan truweel plakspaan 20 кг/м²/см 19 кг/м²/см 7 мин. 15 мин. +/- 20 мин. +/- 45 мин. Eenvoudige toepassing en snelle verwerking Handmatige verwerking én verpompbaar Krimpcompenserend Applicatiedikte: 10-50mm per, voor grotere diktes tot 25% toevoegen Toepassing: Uitvullen, egaliseren en herstellen van balkons vóór de een afwerking (tegels, afwerking) Бетонированные фургоны в кузовах, гаражах, вагонах, ремонтных фургонах THO05DB008 зак 25 кг 48 гр 2,5 л.вода мм plakspaan truweel pomp 20 кг/м²/см > 30 мин макс 8уп. 14 tf

15 Herstelling van betonnen vloeren en wegdekken Thoro Выравниватель люков Snelzettende stelmortel voor het op hoogte stellen van putdeksels, boordstenen, lintelen, poutrellen, kleine metselwerken die snel moeten uitharden, SL Thoro Rapid Primer Snelle LMVORMing Levbaar NA Slechts 5 Minuten Laag Materiaal Verhindert Kratervorming Bij Zelfnivellende Vloeren Tepassinge: Primer Voor Zelfnivellende Vloeren, Zoor Zefnivaleende Vloeren, Zoalsete CementgeBaseerde Mortell Zeer TijdbeSparend, стерке, стеркен, Beperking Van VarkeerShinder Opnieuw Belastbaar Voor Verkeer Na 1 UUR Iinity — en zomerversie: indickiek bij verschillende Temperaturen Bekisting overbodig Toepassing: Op hoogte stellen van putdeksels Als metselspecie voor kleine en snelle herstellingen Snelhardende stelmortel voor bodystenen, lintelen, poutrellen, betonplaten THO05BX001 zak 25 kg 48 grijs 3,4 l. вода 1 zak verhoogt deksel 60 x 60 cm met 2,5 cm THO04AT001 bus 5 литров roze gebruiksklaar 2 schuimrol kortharige rol 20 кг/см/м² мл/м² 1u Applicatiedikte: 5-25mm, пол, stofvrije afwerking Makkelijke en snelle toepassing Goede slijtvastheid en weerbestendig (voor binnen en buiten) Toepassing: beschadigde industrievloeren, betonwegen, парковки, гаражи, traphallen, laadkaden, nieuw beton met regenschade 08kgs 4CGGTHO05 4,7 л.Часть 2 Автобус THO05CG009 20 л. 24 Часть 2 жидкость — THO05CG010 автобус 4,7 л. 96 Часть 2 жидкость мм 1 uitgieten egaliseren met rakel prikrol 1,6 кг/м²/мм > 20 мин. THORO waterdichting belastbaar 24u (belopen) 72 u (volledig) p. 15

16 Принадлежности гидрорасширительного фильтра Thoro Waterpack Гидрорасширительный комплект для открывания дверей. Это сочетание сочетается с Thoro Waterplug. THORO waterdichting Waterdicht, waterdampdicht en gasdicht Blijvend flexibel, hardt niet uit, zeer goede hechting Bestand tot 3-метровый waterdruk Te gebruiken in combinatie met Waterplug Zelfherstellend vermogen bij lichte schade. Прошлые zich aan kabels en doorvoeringen. Кан познакомился с ручным пистолетом, сделанным ангебрахтом. 1 компонент, gebruiksklaar. Uitstekende hechting op droge en vochtige ondergronden. Geen hechtings nodig. Онмидделлийке дихтинг. Dient niet uit te harden. Вселенная в родном. Джин демпфировать. Опломиддельврий. Ниет токсиш. Toepassing: kabeldoorvoeringen, doorvoeringen van waterleiding, gasleiding,… Door wachtbuizen LET OP! Первые 20 минут в теплой воде перед тем, как заняться спортом. искусство. nr verpakking omverpakking kleur THO05AZ004 kit 310 мл 25 groen стандартный силиконовый пистолет 3 кокера на дверцу диам.110мм р. 16 TF

17 KRIMPVRIJ AANGIETEN, VERANKEREN THRO GROUT GP KRIMPGECOMPELINGEERDE GIETMORTEL — OnDersabelingsMortel Voor Precisie-Aangieten Kripparm, расширяющуюся седе Tijdens de Uthardering, Ваарборгт EEN Goede Vulling en Fi Chatie Goede, Eenvoudige Hoge Druksterkte (TOP 72 N / мм² Na 28 Dagen) Tepassing : aangieten машины, kolommen, пален, balken, panelen, verankeren bouten en пален, aangieten en fi xeren van kabels en leidingen bij horizontale doorvoeringen THO05CG003 zak 25 кг 48 grijs Thoro Grip 4 l. вода (4,0-4,6) Проход через дорожную кастрюлю Уитстекенде влоэи Расширить временные интервалы для больших треккингов Waterdicht, voorkomt corrosie van de ankers Hardt uit in slechts 15 min, belastbaar na +/- 90 min Toepassing: verankering machine, trekankers, wapeningsstaven, funderingsbouten, пален, балюстрады,… 10мм 25мм (конструкция) бидж >50мм: всего 30% помола товогена (Sibelco 5-8 из 8-16мм) червячная помпа gieten THO05CG007 зак 25 кг 48 гр 0,18 л. вода/кг gieten 2 кг/дм³ 5 мин 15 мин 1,9 кг/дм³ > 60 мин17

18 Toeslagstoffen Thoro Акрил 60 Hoogwaardige toeslagstof пакета cementmortels операционный базис ван acrylaten Thoro waterdichting Toeslagstof пакета sommige Thoro продукция Sterk verhoogde hechting Verhoogde slijtvastheid Vermindert krimp Verhoogt Chemische weerstand Применение: в aanbrand, uitvlakmortels, cementpleisters, kalkpleisters, reparatiemortels, … искусство . nr verpakking omverpakking kleur toepassing дозирование THO10DH001 автобус 2 л. 8 aanbrand puur THO10DH002 автобус 5 л. 4 / 96 wit melkachtig hecht Cementpleister 1 deel Acryl deel water THO10DH003 автобус 20 л. 24 цементный слой 1 акриловый слой водного бетона ремонтный раствор 1 слой акрилового слоя воды uitvlakmortel / kaleimortel 1 слой акрилового стекла 3 слоя воды Thoro Bond Hechtprimer voor Mineral Producten Verbeterde hechting van horizontal of verticaal tegelwerk Verhoogt hechting van nieuw op oud beton Verbetert hechting tussen цемент-цемент pleisters en mortels op bestaande Minerale ondergronden, hout, metaal,… Hechtprimer voor kaleimortels op verweerde ondergronden, verfresten,… THO04AT004 автобус 5 л. 4 Автобус THO04AT005 20 л. 24 roze gebruiksklaar 1 droogtijd borstel rol 0,1-0,4 л/м² tot kleefvrije fi lm na max 3 dagen afwerken p. 18 t f

19 PE EC ваше здание. ou ur fo oc cu нас. ТОРО водные дихтинг с. 19

20 PE EC THORO Водосточная система вашего здания. ou ur fo oc cu нас. п. 20 t f

Канадские товарные знаки THORO SYSTEM PRODUCTS, INC., (14 товарных знаков)

Поиск торговой марки
>
ТОРО СИСТЕМ ПРОДУКТС, ИНК. ,

Товары и услуги: Краски, грунтовки, акриловые защитные и декоративные покрытия; покрытия на цементной основе; пла…

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Покрытия гидроизоляционные и защитные для бетонных, кирпичных и других поверхностей.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Покрытия гидроизоляционные и защитные для бетона и кирпичной кладки.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Затирки и растворы на цементной основе для заделки, герметизации и ремонта растворных швов и сто…

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Покрытия цементные гидроизоляционные, защитно-восстановительные для бетона и кирпичной кладки.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Строительные материалы, а именно бетонные и строительные растворные смеси.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Краски; защитно-декоративные акриловые, фактурные покрытия; герметики; водоотталкивающий. ..

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Герметизирующая прозрачная композиция для бетона и кирпичной кладки.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Герметик гидравлический цементный для кладки и цемента.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Силиконовый гидрофобизатор для гидроизоляции кирпича, раствора, бетона…

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Жидкий вяжущий агент для добавления к смесям на основе портландцемента, покрытиям или покрытиям f. ..

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Силиконовый водоотталкивающий состав для использования на известняке, горизонтальном бетоне и внутренней штукатурке.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Гидравлический цемент для нанесения на кирпичную кладку или бетон с целью закупоривания трещин. ..

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Товары и услуги: Растворы для перетачивания и затирки швов.

ТОРО СИСТЕМ ПРОДУКТС, ИНК.,

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: Неопределенное смещение: 0

Имя файла: models/Standard_model.PHP

Номер линии: 154

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard. php

Номер линии: 154

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер линии: 155

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Стандарт.PHP

Номер строки: 156

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер строки: 158

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер строки: 159

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Стандарт. PHP

Номер строки: 160

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер линии: 162

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер строки: 164

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Стандарт.PHP

Номер строки: 165

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard.php

Номер линии: 166

Произошла ошибка PHP

Серьезность: Уведомление

Сообщение: попытка доступа к смещению массива по значению типа null

Имя файла: библиотеки/Standard. php

Номер строки: 184


&copy АВТОРСКИЕ ПРАВА ΓΟΝΕΟΣ ΑΕ, 2005-2022

спроектирован и разработан

информационный дизайн

ТОРО СТРУКТУРИТ R4

ТОРО СТРУКТУРИТ R4

 ТОРО СТРУКТУРИТ R4
Mortier de réparation Structurel à Prize Rapide
Описание
THORO STRUCTURITE R4 является порошкообразным цементом
Портленд, отборные соболя, отборные волокна
Спецификация и редиспергируемая полимерная пудра.Меланже с водой THORO STRUCTURITE R4
forme un mortier de reparation à Prize Rapide Modifié par
полимеры.
Le THORO STRUCTURITE R4 выглядит как внешний вид
Бетон (серый цвет).
L’action d’inhibiteur de corrosion organo-fonctionnel
avancée évite laformation de rouille autour des barres
д’арматура.
THORO STRUCTURITE R4 соответствует классу R4
залить растворы по стандарту EN1504-3.
Домен приложения
Ремонт бетона с высоким сопротивлением а-ля
сжатие и быстрое выполнение требований. Ремонт бетона endommagé à la suite de:
- Dommages mecaniques.
- Коррозия арматуры - карбонизация.
- Реакция щелочи - силикаты.
Преимущества

-
Прочный
Отличная приверженность.
Превосходная защита арматуры
épaisseur.
Проницаемый а-ля vapeur d’eau.
Отличное сопротивление циклам гель / дегель.
Modifié par des polymères.

-
Экономик
Приз по рапиду, ок. 30 минут при 20°C.
Монокомпозитный, ajouter seulement de l’eau.

-
Легкое нанесение
Ne pas nécessaire d’utiliser des coffrages.Ne requiree pas de primaire или кушетки
d’accrochage specifique.
PF_THORO STRUCTURITE R4.doc — 11.10.15
№ сертификата. ББ-563-0013-0012-001
Организм серт. BCCA
-
Epaisseur: 5 – 50 мм пар кушетка.
Une version à Prize légèrement
доступный залить gunitage.

-
Экологический
Базовый децимент.
Faible en teneur chrome –
(Cr-VI < 2 частей на миллион энпоидов)
умственно отсталый
Характеристические методы
Физические свойства (а)
Гранулометрия макс.
Модуль эластичности
(ЕН 13412)
Абсорбционная капиллярная вода
(ЕН 13057)
Тенур в хлоре
(EN1015-17)
Механические сопротивления
Сжатие
28 Дж. (ЕН 12190)
Valeur déclarée
0,8 мм
25 200 Н/мм²
≤ 0,36 кг/м2.ч0,5
≤ 0,05 %
≥ 45 Н/мм²
Сгибание
(ЕН 12190)
28 Дж.
≥ 8 Н/мм²
Приверженность
(ЕН 1542)
28 Дж.
2,3 Н/мм²
Приверженность после
28 Дж.
циклы дегель/дегель (EN 13687-1)
2,4 Н/мм²
(a) Специфические оценки. Результаты испытаний в лабораториях
3,25 литра воды/25 кг продукта при любой температуре
постоянная температура 21°C.
1/3
стандартное восточное время
Il est Important de malaxer le produit jusqu'à la
консистенция правильная.
Кулер
Гри.
Барботин
Меланжер пудра THORO STRUCTURITE R4 au
Liquide jusqu'à l'obtention d'une консистенция паштета à
блины.Консомация
± 1,9 кг веса на дм³.
Эмболлаж
Мешки по 25 кг.
Склад
A l'abri du gel, в местной секте, на расстоянии du sol
протеже де л'влажности.
Запасы в ротации для сохранения в течение 12 месяцев
ne soit pas dépassée.
Применение
Качество поверхности
La Surface doit être parfaitement saine et propre.
Подготовка поверхности
Eliminer tous betons endommagés non adhérents ou
contaminés pour revenir à une base saine. 
Dégager autour des armatures corrodées et sur une
longueur de 50 mm de part et d'autre de la zone
атаковать.Saturer le support d’eau et enlever l’excès d’eau.
Couper à la disqueuse des arêtes à angle droit de façon
à menager une épaisseur minimale de 5 mm à la limite
о возмещении ущерба. Les méthodes de découpe à l'eau à ultra
haute pression sont préférables.
Si des outils à percussion sont utilisés, il faut s'assurer
que les bords de coupe restent francs.
Eliminer la rouille des armatures corrodées par sablage
ou grenaillage plutôt que par brossage.
En présence de chlorures, ou s'il n'est pas возможно
d'appliquer une épaisseur min de 5 mm sur les
арматура, les aciers doivent être remis à blanc et traités
de 2 кушетки de THORO STRUCTURITE PRIMER.Меланж
Densite влажный
Жизнеспособность
Начальный временной приз
Финал временного приза
2,10 кг/дм³
10 - 20 минут
окр. 20 минут
окр. 30 минут
Ликвид
Мортье
± 3,25 литра (3,0 – 3,5) питьевой воды / 25 кг порошка.
Барботин
Спрос: от 10 до 15% ликвидных средств плюс que pour la
консистенция дю мортье. 
Механический малаксаж
Дополнительная прогрессивная система THORO STRUCTURITE R4 à
l'eau et mélanger mecaniquement à 400-600 тр./мин.
jusqu’à une constance homogène est obtenue. Лайссер
reposer le mélange 2–3 минуты на перметре aux
редиспергатор полимеров de se.Малаксер в стиле модерн
кулон максимум на 1 минуту, если необходимо
une petite quantité de poudre для получения консистенции
адекватный.
Ne pas mélanger de quantités superieures à Celles
pouvant être mises en œuvre en 10 минут при 20°C.
Ne pas remouiller.
Применение
Ne pas appliquer THORO STRUCTURITE R4 sur des
поверхности gelées ou si la température ambiante est
нижняя до 5°C и верхняя до 30°C, или рискованная
спуск по воде 5°C в течение 8 часов
Аппликатор la barbotine de THORO STRUCTURITE R4
sur une Surface предварительного увлажнения, à l'aide de la brosse
Торо.Brosser énergiquement sur toute la surface,
recouvrir complètement la surface à reparer ainsi que les
aciers de renforcement.
NE PAS LAISSER SECHER.
Аппликатор à la truelle THORO STRUCTURITE R4 sur la
barbotine encore fraîche en pressant fortement pour
compacter entièrement le produit, en portant un soin
особенно в покрытии арматуры. 
Аппликация на кушетки 5 - 50 мм в свободной среде
30 минут при 20°C. Кушетка Griffer Entre Chaque Pour
avoir un meilleur accrochage.
Si THORO STRUCTURITE R4 в полной комплектации
reparation appliquer de nouveau une barbotine.Pour obtenir des profils compliqués appliquer plus de
produit et gratter à la truelle une fois que la Prize initiale a
начать.
Излечивать
Par temps chaud et/ou venteux, испаритель de l'eau sur la
поверхность réparée dès la Prize Initiale et ce, aussi
возможно долгое время.
Полная премия Protéger de la pluie battante jusqu'à.
Посещение минимум 4 часа до восстановления ле
Система защиты THORO STRUCTURITE R4
проницаем для паров воды (при температуре
20°С).
Par temps froid, protéger à l'aide d'une bâche, de
полистирол или изоляция из других материалов.Les produits de curate sont déconseillés.
La quantité d'eau nécessaire peut varier en fonction des
климатические условия. Ne pas dépasser 3,5 л / 25 кг.
PF_THORO STRUCTURITE R4.doc — 11.10.15
2/3
Неттояж
Немедленное использование воды после обеда. 
Гигиена и безопасность
Les consignes appropriées d’hygiène et de sécurité
фигурант в справке по безопасности.
THORO STRUCTURITE R4, базовый цемент,
peut être irritant pour la peau et les yeux. Портер де
брюки и люнеты де защиты. Рекомендовано
d’utiliser
ООН
маска
антипуссьер.Ринсер
непосредственно в проекции. Консультант ООН
médecin en cas d’irritation prolongée. En cas d’ingestion
Faire boire de l’eau ou du lait et consulter un médecin.
Торо
Дистрибьютор:
Координационный центр BASF в Бельгии Комм. V.Business Belux – Строительная химия
Нийверхейдсвег 89
B-3945 Ветчина
www.thoro.be
Тел. +32 11 34 04 32
Факс +32 11 40 13 92
Б.Т.В./Т.В.А. ВЕ 0862.390.376
RPR/RPM Антверпен
Важное примечание: Информационные коммюнике по методике cette fiche не
basées sur notre expérience à ce jour.En aucun cas, elles n'impliquent une garantie
de notre часть, les Conditions d’Utility n’étant pas sous notre control. C'est la
responsabilité de l’utilisateur de s’assurer que le produit convient pour l’application
à laquelle il le destine et que les условия применения неприемлемы. 
Cette édition заменить ла précédente.
PF_THORO STRUCTURITE R4.doc — 11.10.15
3/3
 

Thoroseal Fx 122: Специальные мортеры

Thoroseal Fx 122: Специальные мортеры | CONSULTORIA DE OBRAS .Masterseal 583, ранее называвшийся Super thoroseal. Thoroseal следует хранить под укрытием и вдали от земли. Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера). Перейти к основным результатам поиска. Thoro structurite 300 (r), thoro structurite level, thoro structurite primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100.

Перейти к основным результатам поиска. Po 7 dňoch môžeme daný objekt zaťažiť vodou. Радиоуправляемый квадрокоптер Feilun fx122c6 (wifi fpv, 1-мегапиксельная камера).Подклад музыки ровный, чистый, носный, насыщенный. 4.7 из 5 звезд 78.

混凝土防水用水泥塗料 (Thoroseal) — 松上實業股份有限公司 от tw.allproducts.com Feilun fx122c3 r/c quadcopter camera (5 квадрокоптер). Невероятно, ha merecido la pena esperar. Описание продукта легко применить Перейти к основным результатам поиска. Thoroseal следует хранить под укрытием и вдали от земли. Po 7 dňoch môžeme daný objekt zaťažiť vodou. Нет, он visto cosa igual.Masterseal 610 (старый Masterseal 410).

Подклад музыки бытов ровный, чистый, носовой, насиковый.

Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные мотор-редукторы. 4 flexibele waterdichting thoroseal fx100 & fx122 een flexibele, scheuroverbruggende, цементное базовое покрытие для водоотвода van beton en metselwerk. Thoroseal fx 122 является продуктом с надлежащими компонентами: Thoroseal следует хранить под укрытием и вдали от земли.Po 7 dňoch môžeme daný objekt zaťažiť vodou. Thoro structurite 300 (r), thoro structurite level, thoro structurite Primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100. Masterseal® 599 (ранее известный как thoroseal fx 122). Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера). Masterseal 583, ранее называвшийся Super thoroseal. Подклад музыки ровный, чистый, носный, насыщенный. .thoroseal, thoroseal 200, thoroseal fx110, thoroseal fx 100, thoro тekt cr, выравниватель люков, structurite r4, thoroseal fc, thoroseal wr.Izolácia thoroseal fx 122 sa nanáša štetcom, metlou alebo nehrdzavejúcim hladidlom. Радиоуправляемый квадрокоптер Feilun fx122c6 (wifi fpv, 1-мегапиксельная камера).

Masterseal 940 (старые водные стержни Masterflex). Po 7 dňoch môžeme daný objekt zaťažiť vodou. Thoroseal fx 122 является продуктом, состоящим из следующих компонентов: Изоляция thoroseal fx 122 на основе штеткома, обработанного нейтральным хладидлом. Описание продукта легко наносится

Опорная база | Urob si sám от urobsisam.zoznam.sk Masterseal 940 (старые гидробарьеры masterflex). Masterseal® 599 (ранее известный как thoroseal fx 122). Masterseal 610 (старый Masterseal 410). Подклад музыки ровный, чистый, носный, насыщенный. Радиоуправляемый квадрокоптер Feilun fx122c6 (wifi fpv, 1-мегапиксельная камера). Masterseal 583, ранее называвшийся Super thoroseal. Masterseal 599 (старый thoroseal fx 122). Перейти к основным результатам поиска.

Thoroseal fx 122 является продуктом, состоящим из следующих компонентов:

Masterseal® 599 (ранее известный как Thoroseal fx 122).Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера). Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные двигатели с редуктором. Thoroseal следует хранить под укрытием и вдали от земли. Masterseal 940 (старые водные стержни Masterflex). Thoro structurite 300 (r), thoro structurite level, thoro structurite primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100. может быть даны объекты zaťažiť vodou..thoroseal, thoroseal 200, thoroseal fx110, thoroseal fx 100, thoro тekt cr, выравниватель люков, structurite r4, thoroseal fc, thoroseal wr. Описание продукта легко наносится 4,7 из 5 звезд. Masterseal 599 (старый thoroseal fx 122).

Masterseal® 599 (ранее известный как thoroseal fx 122). Masterseal 583, ранее называвшийся Super thoroseal. Дрон Feilun fx122c3 с креплением на карданном подвесе. Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера)..thoroseal, thoroseal 200, thoroseal fx110, thoroseal fx 100, thoro тekt cr, выравниватель люков, structurite r4, thoroseal fc, thoroseal wr.

Impermeabilizzazione delle Strutture с сайта www.windcrete.it Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные мотор-редукторы. Masterseal 583, ранее называвшийся Super thoroseal. Радиоуправляемый квадрокоптер Feilun fx122c6 (wifi fpv, 1-мегапиксельная камера). Masterseal 599 (старый thoroseal fx 122).Нет, он visto cosa igual. Перейти к основным результатам поиска. Thoroseal следует хранить под укрытием и вдали от земли. Thoroseal fx 122 является продуктом, состоящим из следующих компонентов:

Для 7 дней можно использовать данные объекты для замены воды.

Feilun fx122c6 Радиоуправляемый квадрокоптер (wifi fpv, 1-мегапиксельная камера). Masterseal® 599 (ранее известный как thoroseal fx 122). Izolácia thoroseal fx 122 sa nanáša štetcom, metlou alebo nehrdzavejúcim hladidlom. Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные двигатели с редуктором.Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера). Подклад музыки ровный, чистый, носный, насыщенный. Masterseal 599 (старый thoroseal fx 122). 4 flexibele waterdichting thoroseal fx100 & fx122 een flexibele, scheuroverbruggende, цементное базовое покрытие для водоотвода van beton en metselwerk. Masterseal 940 (старые водные стержни Masterflex). Описание продукта Простой в применении дрон Feilun fx122c3 с креплением на карданном подвесе. Thoroseal следует хранить под укрытием и вдали от земли.Po 7 dňoch môžeme daný objekt zaťažiť vodou.

Источник: urobsisam.zoznam.sk

Thoroseal следует хранить под укрытием и вдали от земли. Радиоуправляемый квадрокоптер Feilun fx122c3 (5-мегапиксельная камера). Радиоуправляемый квадрокоптер Feilun fx122c6 (wifi fpv, 1-мегапиксельная камера). Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные двигатели с редуктором. Дрон Feilun fx122c3 с креплением на карданном подвесе.

Источник: img.abc.lv

Izolácia thoroseal fx 122 sa nanáša štetcom, metlou alebo nehrdzavejúcim hladidlom.Невероятно, ha merecido la pena esperar. Описание легко наносимого продукта Masterseal® 599 (ранее известный как thoroseal fx 122). .thoroseal, thoroseal 200, thoroseal fx110, thoroseal fx 100, thoro тekt cr, выравниватель люков, structurite r4, thoroseal fc, thoroseal wr.

Источник: www.windcrete.it

Feilun fx122c3 Радиоуправляемый квадрокоптер (5-мегапиксельная камера). 4 flexibele waterdichting thoroseal fx100 & fx122 een flexibele, scheuroverbruggende, цементное базовое покрытие для водоотвода van beton en metselwerk.Masterseal® 599 (ранее известный как thoroseal fx 122). Дрон Feilun fx122c3 с креплением на карданном подвесе. Подклад музыки ровный, чистый, носный, насыщенный.

Источник: urobsisam.zoznam.sk

По 7 дням может быть даны объекты заливать воду. Подклад музыки ровный, чистый, носный, насыщенный. Thoro structurite 300 (r), thoro structurite level, thoro structurite Primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100. Fx122, fx122c3 и fx122c6.Masterseal® 599 (ранее известный как thoroseal fx 122).

Источник: www.windcrete.it

No he visto cosa igual. .thoroseal, thoroseal 200, thoroseal fx110, thoroseal fx 100, thoro тekt cr, выравниватель люков, structurite r4, thoroseal fc, thoroseal wr. Они описываются как бесщеточные квадроциклы, однако на самом деле это щеточные двигатели с редуктором. Невероятно, ha merecido la pena esperar. Masterseal 583, ранее называвшийся Super thoroseal.

Источник: tw.allproducts.com

Модели fx122, fx122c3 и fx122c6. 4.7 из 5 звезд 78. Подклад музыки бытов, чисты, носны, насикавы. Thoroseal следует хранить под укрытием и вдали от земли. Izolácia thoroseal fx 122 sa nanáša štetcom, metlou alebo nehrdzavejúcim hladidlom.

Источник: comercialdaroa.files.wordpress.com

Thoro structurite 300 (r), thoro structurite level, thoro structurite Primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100.Дрон Feilun fx122c3 с креплением на карданном подвесе. Подклад музыки ровный, чистый, носный, насыщенный. Нет, он visto cosa igual.

Источник: www.windcrete.it

Перейти к основным результатам поиска. Thoro structurite 300 (r), thoro structurite level, thoro structurite Primer, thoro structurite r4, thoro structurite fr, thoro structurite 100, thoroseal, thoroseal cpb 1, thoroseal fx 100. 4 flexibele waterdichting thoroseal fx100 & fx122 покрытие voor de waterdichting van beton en metselwerk.Описание продукта легко наносится.